Incidental Mutation 'R5684:Sfn'
ID443223
Institutional Source Beutler Lab
Gene Symbol Sfn
Ensembl Gene ENSMUSG00000047281
Gene Namestratifin
Synonyms14-3-3 sigma, Er, MME1, Ywhas
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133600556-133602168 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 133601292 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 160 (K160*)
Ref Sequence ENSEMBL: ENSMUSP00000050374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057311] [ENSMUST00000084238]
Predicted Effect probably null
Transcript: ENSMUST00000057311
AA Change: K160*
SMART Domains Protein: ENSMUSP00000050374
Gene: ENSMUSG00000047281
AA Change: K160*

DomainStartEndE-ValueType
14_3_3 3 244 1.24e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084238
SMART Domains Protein: ENSMUSP00000081260
Gene: ENSMUSG00000037553

DomainStartEndE-ValueType
low complexity region 10 60 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:zf-DHHC 179 308 1.4e-38 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show impaired B-cell homeostasis, BCR signaling, and T cell-independent B-cell responses. Homozygous hypomorphs show altered mammary epithelial morphology. Spontaneous mutants die at birth from respiratory stress with severe anomalies inskin, limbs, tails, face and oral cavity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Sfn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02185:Sfn APN 4 133601325 missense probably benign 0.16
R1775:Sfn UTSW 4 133601231 missense probably damaging 0.99
R2040:Sfn UTSW 4 133601292 missense probably benign 0.03
R4763:Sfn UTSW 4 133601345 missense probably benign 0.04
R5430:Sfn UTSW 4 133601627 missense probably damaging 1.00
R5526:Sfn UTSW 4 133601604 missense probably damaging 1.00
R7605:Sfn UTSW 4 133601237 missense probably damaging 0.96
X0064:Sfn UTSW 4 133601285 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTAGTCCTCTCTGCAGGCTG -3'
(R):5'- GACTCGCACCTCATCAAAGG -3'

Sequencing Primer
(F):5'- CTCTCAGGAGCTGCATGATGAG -3'
(R):5'- ACCTCATCAAAGGGGCTGG -3'
Posted On2016-11-09