Incidental Mutation 'R5684:Grm5'
ID443231
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Nameglutamate receptor, metabotropic 5
SynonymsGlu5R, mGluR5, 6430542K11Rik, Gprc1e
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location87584168-88134907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88130645 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1130 (S1130P)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
Predicted Effect probably benign
Transcript: ENSMUST00000107263
AA Change: S1098P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: S1098P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125009
AA Change: S1098P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: S1098P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155358
AA Change: S1130P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: S1130P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167164
AA Change: S1130P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: S1130P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 88130781 missense probably benign 0.00
IGL00970:Grm5 APN 7 87803896 missense probably damaging 0.97
IGL01286:Grm5 APN 7 87602565 missense probably benign 0.00
IGL01307:Grm5 APN 7 88075012 missense probably damaging 1.00
IGL01603:Grm5 APN 7 87603178 missense probably damaging 1.00
IGL01646:Grm5 APN 7 88040059 missense probably damaging 1.00
IGL01705:Grm5 APN 7 88130046 missense possibly damaging 0.59
IGL02184:Grm5 APN 7 88026442 missense probably damaging 0.98
IGL02504:Grm5 APN 7 88130772 missense probably benign
IGL02689:Grm5 APN 7 87602710 missense probably damaging 1.00
IGL02725:Grm5 APN 7 88074665 missense probably damaging 1.00
IGL02851:Grm5 APN 7 88074710 missense probably damaging 0.98
IGL03106:Grm5 APN 7 88036070 missense probably damaging 1.00
IGL03257:Grm5 APN 7 87602898 missense possibly damaging 0.69
IGL03291:Grm5 APN 7 88130796 missense probably damaging 1.00
R0078:Grm5 UTSW 7 88074977 missense probably damaging 1.00
R0314:Grm5 UTSW 7 87602955 missense probably damaging 0.97
R0318:Grm5 UTSW 7 87602967 missense probably damaging 0.99
R0364:Grm5 UTSW 7 88074386 missense probably damaging 1.00
R0380:Grm5 UTSW 7 88074376 missense possibly damaging 0.92
R0454:Grm5 UTSW 7 88130789 missense probably damaging 1.00
R0494:Grm5 UTSW 7 88130781 missense probably benign 0.00
R0562:Grm5 UTSW 7 87603019 missense probably damaging 1.00
R1695:Grm5 UTSW 7 88036103 missense possibly damaging 0.47
R2012:Grm5 UTSW 7 88074872 missense probably damaging 1.00
R2384:Grm5 UTSW 7 87602728 missense probably damaging 1.00
R2510:Grm5 UTSW 7 88036091 missense probably benign 0.21
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R3861:Grm5 UTSW 7 88129994 missense possibly damaging 0.94
R4451:Grm5 UTSW 7 88075132 critical splice donor site probably null
R4626:Grm5 UTSW 7 88130153 missense probably damaging 1.00
R4728:Grm5 UTSW 7 87975288 missense probably damaging 1.00
R4914:Grm5 UTSW 7 88130129 missense probably benign 0.00
R5122:Grm5 UTSW 7 88074820 missense probably damaging 1.00
R5352:Grm5 UTSW 7 88074850 missense probably damaging 1.00
R5361:Grm5 UTSW 7 88074496 missense probably damaging 1.00
R5715:Grm5 UTSW 7 88130256 missense probably benign 0.05
R5759:Grm5 UTSW 7 88026600 missense probably damaging 0.96
R5844:Grm5 UTSW 7 87804024 missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87603073 missense probably damaging 1.00
R6048:Grm5 UTSW 7 88026550 missense probably damaging 1.00
R6145:Grm5 UTSW 7 88026601 missense probably damaging 1.00
R6232:Grm5 UTSW 7 87602430 unclassified probably benign
R6972:Grm5 UTSW 7 87602923 missense probably benign 0.02
R7072:Grm5 UTSW 7 88074304 missense probably damaging 1.00
R7258:Grm5 UTSW 7 88074706 missense probably damaging 0.96
R7316:Grm5 UTSW 7 87975265 missense probably benign
R7434:Grm5 UTSW 7 88130474 missense probably benign 0.10
R7521:Grm5 UTSW 7 88074272 missense possibly damaging 0.86
R7616:Grm5 UTSW 7 88116201 missense probably benign
R7631:Grm5 UTSW 7 87975305 missense probably damaging 1.00
R7655:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7656:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7739:Grm5 UTSW 7 88130058 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTCCATGATGTTGTCCACCG -3'
(R):5'- GGCTCACAACGATGAAGAACTC -3'

Sequencing Primer
(F):5'- GTTGTCCACCGCGGCTG -3'
(R):5'- CGATGAAGAACTCTGCGTGTAATCTC -3'
Posted On2016-11-09