Incidental Mutation 'R5684:Slc6a2'
ID443237
Institutional Source Beutler Lab
Gene Symbol Slc6a2
Ensembl Gene ENSMUSG00000055368
Gene Namesolute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonymsnorepinephrine transporter, NE transporter, Slc6a5, NET
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92960079-93001667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92989053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 273 (V273D)
Ref Sequence ENSEMBL: ENSMUSP00000129869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072939] [ENSMUST00000165470]
Predicted Effect probably damaging
Transcript: ENSMUST00000072939
AA Change: V273D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072709
Gene: ENSMUSG00000055368
AA Change: V273D

DomainStartEndE-ValueType
Pfam:SNF 56 580 4.7e-242 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165470
AA Change: V273D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129869
Gene: ENSMUSG00000055368
AA Change: V273D

DomainStartEndE-ValueType
Pfam:SNF 56 580 4.7e-242 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium:neurotransmitter symporter family. This member is a multi-pass membrane protein, which is responsible for reuptake of norepinephrine into presynaptic nerve terminals and is a regulator of norepinephrine homeostasis. Mutations in this gene cause orthostatic intolerance, a syndrome characterized by lightheadedness, fatigue, altered mentation and syncope. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Norepinephrine homeostasis is abnormal in homozygous mutant mice. In addition to displaying altered behavior, mutant mice are hypersensitive to psychostimulants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Slc6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Slc6a2 APN 8 92997057 missense possibly damaging 0.57
IGL00864:Slc6a2 APN 8 92995994 missense probably benign 0.02
IGL00910:Slc6a2 APN 8 92996100 missense probably damaging 1.00
IGL01531:Slc6a2 APN 8 92995682 missense probably damaging 1.00
IGL02209:Slc6a2 APN 8 92994060 missense probably benign 0.41
IGL02962:Slc6a2 APN 8 92972762 nonsense probably null
IGL03391:Slc6a2 APN 8 92961452 missense probably damaging 1.00
H8786:Slc6a2 UTSW 8 92994640 missense probably benign 0.03
R0308:Slc6a2 UTSW 8 92961360 missense possibly damaging 0.83
R0632:Slc6a2 UTSW 8 92992801 splice site probably benign
R0765:Slc6a2 UTSW 8 92989031 missense probably damaging 0.96
R1250:Slc6a2 UTSW 8 92992863 missense probably benign 0.12
R1444:Slc6a2 UTSW 8 92971254 missense probably damaging 0.99
R1637:Slc6a2 UTSW 8 92981990 missense probably benign 0.00
R1699:Slc6a2 UTSW 8 92972812 missense possibly damaging 0.95
R1760:Slc6a2 UTSW 8 92961218 splice site probably benign
R2046:Slc6a2 UTSW 8 92972926 nonsense probably null
R2169:Slc6a2 UTSW 8 92994101 missense probably benign 0.12
R2182:Slc6a2 UTSW 8 92961248 start codon destroyed probably null 0.00
R3107:Slc6a2 UTSW 8 92961278 missense probably benign 0.26
R3880:Slc6a2 UTSW 8 92990218 missense probably damaging 1.00
R5092:Slc6a2 UTSW 8 92994719 missense possibly damaging 0.87
R6218:Slc6a2 UTSW 8 92981981 missense probably benign
R6932:Slc6a2 UTSW 8 92996025 missense probably benign 0.00
R7201:Slc6a2 UTSW 8 92995672 missense probably damaging 1.00
R7910:Slc6a2 UTSW 8 92994138 missense possibly damaging 0.53
R8320:Slc6a2 UTSW 8 92992848 missense probably benign 0.31
R8920:Slc6a2 UTSW 8 92961362 missense probably benign
R8963:Slc6a2 UTSW 8 92989074 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCTCCAACACTAGGAGAAGGG -3'
(R):5'- GCCTTGATCTACCTCACAGTG -3'

Sequencing Primer
(F):5'- CTCCAACACTAGGAGAAGGGAAGTG -3'
(R):5'- GATCTACCTCACAGTGGTAAGCTAG -3'
Posted On2016-11-09