Incidental Mutation 'R5684:Sorbs3'
ID443246
Institutional Source Beutler Lab
Gene Symbol Sorbs3
Ensembl Gene ENSMUSG00000022091
Gene Namesorbin and SH3 domain containing 3
SynonymsSH3P3, Sh3d4, vinexin beta, vinexin alpha
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70180468-70211989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70181222 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 717 (R717Q)
Ref Sequence ENSEMBL: ENSMUSP00000022682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000022682] [ENSMUST00000153735] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]
Predicted Effect probably benign
Transcript: ENSMUST00000022681
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022682
AA Change: R717Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091
AA Change: R717Q

DomainStartEndE-ValueType
Sorb 165 214 6.87e-30 SMART
SH3 447 502 9.24e-21 SMART
SH3 521 578 4.18e-19 SMART
low complexity region 597 613 N/A INTRINSIC
SH3 677 733 8.31e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000153735
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227259
AA Change: R664Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227653
AA Change: R664Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000227929
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Sorbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sorbs3 APN 14 70191155 missense probably damaging 1.00
IGL01144:Sorbs3 APN 14 70191568 missense probably benign 0.04
IGL01155:Sorbs3 APN 14 70199341 missense probably damaging 1.00
IGL01465:Sorbs3 APN 14 70195509 splice site probably benign
IGL02184:Sorbs3 APN 14 70184006 critical splice donor site probably null
R0544:Sorbs3 UTSW 14 70193926 missense probably benign 0.01
R0882:Sorbs3 UTSW 14 70207572 missense probably damaging 1.00
R1445:Sorbs3 UTSW 14 70193646 missense probably benign 0.12
R1493:Sorbs3 UTSW 14 70192627 missense possibly damaging 0.71
R1505:Sorbs3 UTSW 14 70190802 nonsense probably null
R1671:Sorbs3 UTSW 14 70191466 missense possibly damaging 0.92
R2184:Sorbs3 UTSW 14 70191431 critical splice donor site probably null
R3804:Sorbs3 UTSW 14 70199351 splice site probably benign
R4527:Sorbs3 UTSW 14 70207617 missense probably damaging 1.00
R4755:Sorbs3 UTSW 14 70184099 missense probably benign 0.00
R4926:Sorbs3 UTSW 14 70186945 missense probably damaging 1.00
R5257:Sorbs3 UTSW 14 70185034 missense probably benign 0.00
R5304:Sorbs3 UTSW 14 70184896 nonsense probably null
R5328:Sorbs3 UTSW 14 70181174 missense probably damaging 1.00
R5988:Sorbs3 UTSW 14 70203303 missense probably benign 0.03
R6106:Sorbs3 UTSW 14 70192604 splice site probably null
R7207:Sorbs3 UTSW 14 70201485 missense probably damaging 1.00
R7562:Sorbs3 UTSW 14 70207527 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGGGAATCGGACTTCAAG -3'
(R):5'- GGAGTTAGTGCTGTGCAAAG -3'

Sequencing Primer
(F):5'- ATCGGACTTCAAGGAGGCTTG -3'
(R):5'- AGTTAGTGCTGTGCAAAGTTGTC -3'
Posted On2016-11-09