Incidental Mutation 'H8562:Vcp'
ID44325
Institutional Source Beutler Lab
Gene Symbol Vcp
Ensembl Gene ENSMUSG00000028452
Gene Namevalosin containing protein
SynonymsAAA ATPase p97, p97/VCP, p97, CDC48
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42979963-43000507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42982596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 699 (I699F)
Ref Sequence ENSEMBL: ENSMUSP00000030164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000139127]
PDB Structure
STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030164
AA Change: I699F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: I699F

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154541
Meta Mutation Damage Score 0.9306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Vcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Vcp APN 4 42996040 missense possibly damaging 0.69
IGL02251:Vcp APN 4 42988728 missense possibly damaging 0.49
R0627:Vcp UTSW 4 42983011 missense possibly damaging 0.83
R0639:Vcp UTSW 4 42982565 missense probably benign 0.00
R0711:Vcp UTSW 4 42986201 missense probably benign 0.22
R0766:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1312:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1702:Vcp UTSW 4 42990840 missense probably damaging 1.00
R2071:Vcp UTSW 4 42995894 critical splice donor site probably null
R2192:Vcp UTSW 4 42982547 missense probably benign
R2262:Vcp UTSW 4 42980828 missense probably benign 0.04
R2265:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2268:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2269:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2443:Vcp UTSW 4 42983385 missense probably damaging 1.00
R2937:Vcp UTSW 4 42980846 missense probably damaging 1.00
R2973:Vcp UTSW 4 42996315 missense probably damaging 1.00
R4004:Vcp UTSW 4 42983028 missense probably damaging 1.00
R4488:Vcp UTSW 4 42993826 missense probably damaging 0.96
R4546:Vcp UTSW 4 42988813 intron probably benign
R4578:Vcp UTSW 4 42984565 missense probably benign 0.41
R4817:Vcp UTSW 4 42983486 missense probably damaging 1.00
R4869:Vcp UTSW 4 42993691 missense probably benign 0.00
R5014:Vcp UTSW 4 42980828 missense probably benign 0.04
R6128:Vcp UTSW 4 42980941 missense probably benign 0.00
R6594:Vcp UTSW 4 42993826 missense probably damaging 0.96
R7105:Vcp UTSW 4 42985991 missense probably damaging 1.00
R7470:Vcp UTSW 4 42982891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGAGTCAACCCGTCTCTTTCTAC -3'
(R):5'- CAGGTGCAGAGTTGTCAGCCATAG -3'

Sequencing Primer
(F):5'- TAGAATAGGTTCTATCACACCCTGC -3'
(R):5'- GTTGTCAGCCATAGGAACTTTTTTC -3'
Posted On2013-06-11