Incidental Mutation 'R5684:Vmn2r103'
ID443251
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19792989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 124 (I124S)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: I124S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I124S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 19811943 missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 19812384 missense probably benign 0.01
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTGATTTTATGCCACTTTCACAGG -3'
(R):5'- TTAGACCTGTAAGTCTCAAGGAC -3'

Sequencing Primer
(F):5'- TTATGCCACTTTCACAGGTATAAC -3'
(R):5'- CCAACCTTTATTTTACAAGGGAGAG -3'
Posted On2016-11-09