Incidental Mutation 'R5685:Olfr1102'
ID443264
Institutional Source Beutler Lab
Gene Symbol Olfr1102
Ensembl Gene ENSMUSG00000049843
Gene Nameolfactory receptor 1102
SynonymsMOR179-4, GA_x6K02T2Q125-48487992-48488966
Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86998398-87003618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87002277 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 103 (S103T)
Ref Sequence ENSEMBL: ENSMUSP00000149634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]
Predicted Effect probably benign
Transcript: ENSMUST00000055129
AA Change: S103T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: S103T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7tm_4 43 320 8.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 47 322 8.7e-6 PFAM
Pfam:7tm_1 53 302 3.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214002
AA Change: S103T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Olfr1102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1102 APN 2 87002923 missense probably benign 0.31
IGL01584:Olfr1102 APN 2 87002151 missense probably benign 0.04
IGL01913:Olfr1102 APN 2 87002820 missense possibly damaging 0.68
IGL02672:Olfr1102 APN 2 87002073 missense probably benign 0.00
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R1674:Olfr1102 UTSW 2 87002233 missense probably benign 0.07
R1688:Olfr1102 UTSW 2 87002386 missense probably benign 0.01
R3826:Olfr1102 UTSW 2 87002044 missense probably damaging 0.97
R3925:Olfr1102 UTSW 2 87002374 missense possibly damaging 0.91
R4023:Olfr1102 UTSW 2 87002922 nonsense probably null
R4730:Olfr1102 UTSW 2 87002166 missense possibly damaging 0.48
R5154:Olfr1102 UTSW 2 87002038 missense probably benign 0.00
R5525:Olfr1102 UTSW 2 87002339 missense possibly damaging 0.95
R5788:Olfr1102 UTSW 2 87002301 missense probably benign 0.01
R6280:Olfr1102 UTSW 2 87002020 missense probably damaging 0.99
R7178:Olfr1102 UTSW 2 87002535 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGGATTCACAGATGATGTTGACATG -3'
(R):5'- CGTAGCATGTAAAATTCCACCAG -3'

Sequencing Primer
(F):5'- ATCGAGGATTCACGGCT -3'
(R):5'- GCATGTAAAATTCCACCAGTATAGG -3'
Posted On2016-11-09