Mutagenetix > Incidental Mutation

Incidental Mutation 'R5685:Aqr'

443265

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5685 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114156265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 208 (D208G)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043160
AA Change: D208G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: D208G

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102543
AA Change: D208G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: D208G

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	T	A	7: 44,230,550		probably benign	Het
4921501E09Rik	T	A	17: 33,066,772	H352L	probably benign	Het
Abcb5	A	T	12: 118,932,613		probably null	Het
Abcg1	G	T	17: 31,098,286	E191*	probably null	Het
Als2	A	G	1: 59,179,091	Y1263H	possibly damaging	Het
Amer2	T	A	14: 60,379,577	L281*	probably null	Het
Anxa6	T	C	11: 54,996,370	N361D	probably benign	Het
Ap1g1	A	T	8: 109,837,783	N320I	probably damaging	Het
Arnt2	T	C	7: 84,263,265	T545A	probably benign	Het
Aspm	G	A	1: 139,487,288	V2701I	probably benign	Het
Atad2	A	G	15: 58,116,798	V106A	possibly damaging	Het
Bbs2	A	C	8: 94,087,433	F186V	probably damaging	Het
Catsperg2	G	A	7: 29,701,188	P247L	probably damaging	Het
Cfap57	G	T	4: 118,569,459	Q1098K	probably benign	Het
Cxcr6	A	G	9: 123,810,746	T271A	probably benign	Het
Dock1	A	G	7: 134,772,362	E579G	probably benign	Het
Frem3	A	G	8: 80,695,303	T2111A	probably damaging	Het
Galnt1	A	T	18: 24,264,529	D229V	possibly damaging	Het
Gbp2b	A	C	3: 142,608,158	M400L	probably benign	Het
Gm1123	T	A	9: 99,009,433		probably null	Het
Gtpbp6	T	C	5: 110,104,939	H349R	probably damaging	Het
Hyal5	A	G	6: 24,876,692	K188R	probably benign	Het
Insrr	T	C	3: 87,800,496		probably null	Het
Kcnn1	A	T	8: 70,852,730	C322S	probably damaging	Het
Kdelr1	GTCTA	G	7: 45,881,617		probably null	Het
Kif23	T	C	9: 61,945,409	T8A	probably benign	Het
Lrrk2	A	T	15: 91,803,301	R2198*	probably null	Het
Mcl1	T	G	3: 95,659,798	D177E	possibly damaging	Het
Mrps11	A	T	7: 78,791,880	T137S	probably benign	Het
Mtbp	A	G	15: 55,562,772	Y90C	probably damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nxt1	G	T	2: 148,675,753	W138L	possibly damaging	Het
Olfr1042	T	C	2: 86,159,795	T192A	probably damaging	Het
Olfr1102	T	A	2: 87,002,277	S103T	probably benign	Het
Olfr183	T	A	16: 59,000,346	F220L	probably benign	Het
Osbpl7	C	A	11: 97,060,277	P478H	probably damaging	Het
Pitpna	T	A	11: 75,620,269	F222I	probably damaging	Het
Plekhh2	A	T	17: 84,569,882	R552W	probably damaging	Het
Plxnb2	C	T	15: 89,167,032	R328H	probably damaging	Het
Pmaip1	C	T	18: 66,460,984	T65I	probably benign	Het
Ppil4	T	G	10: 7,798,422	I110S	probably damaging	Het
Prpf38a	A	G	4: 108,570,154		probably null	Het
Psme4	G	A	11: 30,809,837	G320D	probably damaging	Het
Rab17	C	A	1: 90,958,957	R191L	probably benign	Het
Rhag	A	T	17: 40,831,331	M222L	possibly damaging	Het
Rims2	A	T	15: 39,437,206	H111L	possibly damaging	Het
Setx	T	C	2: 29,171,280	Y2234H	probably damaging	Het
Slc2a8	T	C	2: 32,981,789	I51V	possibly damaging	Het
Slc34a1	T	C	13: 55,401,272		probably null	Het
Slf1	T	C	13: 77,083,479	T594A	possibly damaging	Het
Sox6	A	T	7: 115,579,157		probably null	Het
Spata13	C	T	14: 60,691,203	S70L	probably benign	Het
Stard13	A	G	5: 151,063,127	I188T	possibly damaging	Het
Stard9	A	G	2: 120,705,322	D4020G	probably damaging	Het
Tdp1	A	G	12: 99,902,352	K255R	possibly damaging	Het
Tns2	G	T	15: 102,107,103	A124S	probably benign	Het
Top2b	T	A	14: 16,413,666	W1045R	probably damaging	Het
Trav12-2	T	C	14: 53,616,665	V32A	probably damaging	Het
Vps13c	G	T	9: 67,963,173	R3198L	possibly damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zfp52	T	A	17: 21,561,751	S620R	probably benign	Het
Zfp62	T	A	11: 49,216,217	C378*	probably null	Het
Zfp638	C	A	6: 83,929,987	P378H	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GGTGAGTGACCAAAATCTACTTG -3'
(R):5'- GCCACATATCTGAAGAGACTAGC -3'

Sequencing Primer
(F):5'- GAAGACCTGAGCTTGTTCCCTAG -3'
(R):5'- CTGAAGAGACTAGCTAATGTTCAATC -3'

Posted On

2016-11-09