Incidental Mutation 'R5685:Aqr'
ID443265
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114156265 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 208 (D208G)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043160
AA Change: D208G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: D208G

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102543
AA Change: D208G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: D208G

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131785
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
R8904:Aqr UTSW 2 114136993 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGTGAGTGACCAAAATCTACTTG -3'
(R):5'- GCCACATATCTGAAGAGACTAGC -3'

Sequencing Primer
(F):5'- GAAGACCTGAGCTTGTTCCCTAG -3'
(R):5'- CTGAAGAGACTAGCTAATGTTCAATC -3'
Posted On2016-11-09