Incidental Mutation 'R5685:Nkpd1'
ID443279
Institutional Source Beutler Lab
Gene Symbol Nkpd1
Ensembl Gene ENSMUSG00000060621
Gene NameNTPase, KAP family P-loop domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19517838-19525056 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 19523573 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 276 (Q276*)
Ref Sequence ENSEMBL: ENSMUSP00000151162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078908] [ENSMUST00000207576] [ENSMUST00000214205]
Predicted Effect probably null
Transcript: ENSMUST00000078908
AA Change: Q426*
SMART Domains Protein: ENSMUSP00000077943
Gene: ENSMUSG00000060621
AA Change: Q426*

DomainStartEndE-ValueType
low complexity region 71 103 N/A INTRINSIC
low complexity region 129 158 N/A INTRINSIC
Pfam:KAP_NTPase 186 642 5.7e-29 PFAM
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207576
AA Change: Q426*
Predicted Effect probably null
Transcript: ENSMUST00000214205
AA Change: Q276*
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Nkpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nkpd1 APN 7 19518749 missense possibly damaging 0.71
IGL01140:Nkpd1 APN 7 19523462 missense possibly damaging 0.72
IGL01450:Nkpd1 APN 7 19523625 missense probably damaging 1.00
R0003:Nkpd1 UTSW 7 19519927 missense probably benign
R0626:Nkpd1 UTSW 7 19523174 missense probably benign 0.02
R1171:Nkpd1 UTSW 7 19524087 missense possibly damaging 0.94
R1637:Nkpd1 UTSW 7 19523979 missense probably benign 0.00
R1722:Nkpd1 UTSW 7 19523921 missense possibly damaging 0.84
R1823:Nkpd1 UTSW 7 19523252 missense probably damaging 1.00
R2141:Nkpd1 UTSW 7 19524237 missense probably damaging 0.99
R2224:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2225:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2226:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2274:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2275:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2374:Nkpd1 UTSW 7 19523975 missense possibly damaging 0.50
R3108:Nkpd1 UTSW 7 19522978 missense probably damaging 0.98
R4940:Nkpd1 UTSW 7 19523573 nonsense probably null
R5182:Nkpd1 UTSW 7 19523256 missense probably damaging 1.00
R5362:Nkpd1 UTSW 7 19523268 missense probably damaging 1.00
R5458:Nkpd1 UTSW 7 19524276 missense probably damaging 1.00
R5681:Nkpd1 UTSW 7 19523573 nonsense probably null
R5684:Nkpd1 UTSW 7 19523573 nonsense probably null
R6177:Nkpd1 UTSW 7 19523084 missense probably damaging 1.00
R6200:Nkpd1 UTSW 7 19524603 missense possibly damaging 0.55
R7348:Nkpd1 UTSW 7 19524416 missense probably damaging 0.99
R7356:Nkpd1 UTSW 7 19523774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGTGTACTCGGTGCTAG -3'
(R):5'- ACAGCAGAGTGTTGATGGCG -3'

Sequencing Primer
(F):5'- TGTACTCGGTGCTAGGCAAC -3'
(R):5'- GTTTAGGACGCCCACCAC -3'
Posted On2016-11-09