Incidental Mutation 'R5685:Kdelr1'
ID443282
Institutional Source Beutler Lab
Gene Symbol Kdelr1
Ensembl Gene ENSMUSG00000002778
Gene NameKDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Synonyms8030486F04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5685 (G1)
Quality Score147
Status Not validated
Chromosome7
Chromosomal Location45872772-45883732 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTCTA to G at 45881617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002855] [ENSMUST00000211234] [ENSMUST00000211250] [ENSMUST00000211716]
Predicted Effect probably null
Transcript: ENSMUST00000002855
SMART Domains Protein: ENSMUSP00000002855
Gene: ENSMUSG00000002778

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:ER_lumen_recept 28 169 7.5e-58 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133022
Predicted Effect probably null
Transcript: ENSMUST00000211234
Predicted Effect probably benign
Transcript: ENSMUST00000211250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211495
Predicted Effect probably benign
Transcript: ENSMUST00000211716
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced single point mutation display thymus hypoplasia and a reduction in CD4+ as well as CD8+ T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Kdelr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02822:Kdelr1 APN 7 45873864 splice site probably benign
daniel_gray UTSW 7 45881621 missense probably damaging 1.00
R0269:Kdelr1 UTSW 7 45874039 splice site probably benign
R4677:Kdelr1 UTSW 7 45873773 missense probably benign 0.18
R7098:Kdelr1 UTSW 7 45874056 missense possibly damaging 0.66
W0251:Kdelr1 UTSW 7 45881621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCACATCTTGGGTG -3'
(R):5'- GCCCATGGAATACAGGAGTG -3'

Sequencing Primer
(F):5'- CACATCTTGGGTGCTAGGGTCC -3'
(R):5'- TGGGGAGAGAGCAGACCCC -3'
Posted On2016-11-09