Mutagenetix > Incidental Mutations

Incidental Mutation 'R5685:Arnt2'

443284

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5685 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84263265 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 545 (T545A)

Ref Sequence

ENSEMBL: ENSMUSP00000147129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000208232] [ENSMUST00000209133]

Predicted Effect

probably benign
Transcript: ENSMUST00000085077
AA Change: T556A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: T556A

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207459

Predicted Effect

probably benign
Transcript: ENSMUST00000208232
AA Change: T545A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

unknown
Transcript: ENSMUST00000208564
AA Change: T77A

Predicted Effect

probably benign
Transcript: ENSMUST00000209133
AA Change: T545A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	T	A	7: 44,230,550		probably benign	Het
4921501E09Rik	T	A	17: 33,066,772	H352L	probably benign	Het
Abcb5	A	T	12: 118,932,613		probably null	Het
Abcg1	G	T	17: 31,098,286	E191*	probably null	Het
Als2	A	G	1: 59,179,091	Y1263H	possibly damaging	Het
Amer2	T	A	14: 60,379,577	L281*	probably null	Het
Anxa6	T	C	11: 54,996,370	N361D	probably benign	Het
Ap1g1	A	T	8: 109,837,783	N320I	probably damaging	Het
Aqr	T	C	2: 114,156,265	D208G	possibly damaging	Het
Aspm	G	A	1: 139,487,288	V2701I	probably benign	Het
Atad2	A	G	15: 58,116,798	V106A	possibly damaging	Het
Bbs2	A	C	8: 94,087,433	F186V	probably damaging	Het
Catsperg2	G	A	7: 29,701,188	P247L	probably damaging	Het
Cfap57	G	T	4: 118,569,459	Q1098K	probably benign	Het
Cxcr6	A	G	9: 123,810,746	T271A	probably benign	Het
Dock1	A	G	7: 134,772,362	E579G	probably benign	Het
Frem3	A	G	8: 80,695,303	T2111A	probably damaging	Het
Galnt1	A	T	18: 24,264,529	D229V	possibly damaging	Het
Gbp2b	A	C	3: 142,608,158	M400L	probably benign	Het
Gm1123	T	A	9: 99,009,433		probably null	Het
Gtpbp6	T	C	5: 110,104,939	H349R	probably damaging	Het
Hyal5	A	G	6: 24,876,692	K188R	probably benign	Het
Insrr	T	C	3: 87,800,496		probably null	Het
Kcnn1	A	T	8: 70,852,730	C322S	probably damaging	Het
Kdelr1	GTCTA	G	7: 45,881,617		probably null	Het
Kif23	T	C	9: 61,945,409	T8A	probably benign	Het
Lrrk2	A	T	15: 91,803,301	R2198*	probably null	Het
Mcl1	T	G	3: 95,659,798	D177E	possibly damaging	Het
Mrps11	A	T	7: 78,791,880	T137S	probably benign	Het
Mtbp	A	G	15: 55,562,772	Y90C	probably damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nxt1	G	T	2: 148,675,753	W138L	possibly damaging	Het
Olfr1042	T	C	2: 86,159,795	T192A	probably damaging	Het
Olfr1102	T	A	2: 87,002,277	S103T	probably benign	Het
Olfr183	T	A	16: 59,000,346	F220L	probably benign	Het
Osbpl7	C	A	11: 97,060,277	P478H	probably damaging	Het
Pitpna	T	A	11: 75,620,269	F222I	probably damaging	Het
Plekhh2	A	T	17: 84,569,882	R552W	probably damaging	Het
Plxnb2	C	T	15: 89,167,032	R328H	probably damaging	Het
Pmaip1	C	T	18: 66,460,984	T65I	probably benign	Het
Ppil4	T	G	10: 7,798,422	I110S	probably damaging	Het
Prpf38a	A	G	4: 108,570,154		probably null	Het
Psme4	G	A	11: 30,809,837	G320D	probably damaging	Het
Rab17	C	A	1: 90,958,957	R191L	probably benign	Het
Rhag	A	T	17: 40,831,331	M222L	possibly damaging	Het
Rims2	A	T	15: 39,437,206	H111L	possibly damaging	Het
Setx	T	C	2: 29,171,280	Y2234H	probably damaging	Het
Slc2a8	T	C	2: 32,981,789	I51V	possibly damaging	Het
Slc34a1	T	C	13: 55,401,272		probably null	Het
Slf1	T	C	13: 77,083,479	T594A	possibly damaging	Het
Sox6	A	T	7: 115,579,157		probably null	Het
Spata13	C	T	14: 60,691,203	S70L	probably benign	Het
Stard13	A	G	5: 151,063,127	I188T	possibly damaging	Het
Stard9	A	G	2: 120,705,322	D4020G	probably damaging	Het
Tdp1	A	G	12: 99,902,352	K255R	possibly damaging	Het
Tns2	G	T	15: 102,107,103	A124S	probably benign	Het
Top2b	T	A	14: 16,413,666	W1045R	probably damaging	Het
Trav12-2	T	C	14: 53,616,665	V32A	probably damaging	Het
Vps13c	G	T	9: 67,963,173	R3198L	possibly damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zfp52	T	A	17: 21,561,751	S620R	probably benign	Het
Zfp62	T	A	11: 49,216,217	C378*	probably null	Het
Zfp638	C	A	6: 83,929,987	P378H	probably damaging	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7898:Arnt2	UTSW	7	84268947	splice site	probably null
R8386:Arnt2	UTSW	7	84347539	missense	probably damaging	1.00
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- ACCCAGCTCTCAATGTGTC -3'
(R):5'- AGGACCTCTGGGCAATGTAC -3'

Sequencing Primer
(F):5'- AGCTCTCAATGTGTCCAGAGG -3'
(R):5'- CCTCTGGGCAATGTACAAGAAG -3'

Posted On

2016-11-09