Incidental Mutation 'R5685:Kcnn1'
ID443288
Institutional Source Beutler Lab
Gene Symbol Kcnn1
Ensembl Gene ENSMUSG00000002908
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
SynonymsSK1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70842049-70863258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70852730 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 322 (C322S)
Ref Sequence ENSEMBL: ENSMUSP00000148615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212086] [ENSMUST00000212243] [ENSMUST00000212414] [ENSMUST00000212509] [ENSMUST00000212611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110078
AA Change: C279S

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908
AA Change: C279S

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110081
AA Change: C279S

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908
AA Change: C279S

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212084
Predicted Effect probably damaging
Transcript: ENSMUST00000212086
AA Change: C322S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212243
AA Change: C7S

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212414
Predicted Effect probably damaging
Transcript: ENSMUST00000212509
AA Change: C279S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212611
AA Change: C279S

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal hippocampal morphology and afterhyperpolarization currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Kcnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kcnn1 APN 8 70848062 missense probably benign
IGL00498:Kcnn1 APN 8 70852880 missense probably damaging 1.00
IGL00792:Kcnn1 APN 8 70854716 missense probably benign 0.01
IGL03122:Kcnn1 APN 8 70855080 missense probably damaging 1.00
IGL03137:Kcnn1 APN 8 70850737 missense probably damaging 0.97
IGL03222:Kcnn1 APN 8 70848199 missense probably damaging 1.00
IGL03226:Kcnn1 APN 8 70846491 splice site probably benign
R0586:Kcnn1 UTSW 8 70863869 unclassified probably benign
R1218:Kcnn1 UTSW 8 70852688 missense probably benign 0.07
R1437:Kcnn1 UTSW 8 70844551 missense probably benign 0.03
R1510:Kcnn1 UTSW 8 70864070 unclassified probably benign
R2434:Kcnn1 UTSW 8 70855166 small deletion probably benign
R2860:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R2861:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R4327:Kcnn1 UTSW 8 70852663 missense probably damaging 0.99
R4807:Kcnn1 UTSW 8 70848178 missense probably damaging 0.99
R4947:Kcnn1 UTSW 8 70844429 missense probably benign 0.02
R5265:Kcnn1 UTSW 8 70854653 missense probably benign 0.07
R6108:Kcnn1 UTSW 8 70855156 missense probably benign 0.27
R6523:Kcnn1 UTSW 8 70846525 missense possibly damaging 0.57
R7512:Kcnn1 UTSW 8 70854649 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATAGTCCCCAGCCAGAGATC -3'
(R):5'- ACTATCGCTTCACGTGGACG -3'

Sequencing Primer
(F):5'- AGCCAGAGATCCTGAGGTC -3'
(R):5'- GCACGACTGGCCTTCTC -3'
Posted On2016-11-09