Incidental Mutation 'R5685:Kif23'
ID443292
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Namekinesin family member 23
SynonymsMKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location61915905-61946774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61945409 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000034815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
Predicted Effect probably benign
Transcript: ENSMUST00000034815
AA Change: T8A

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: T8A

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
AA Change: T8A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215404
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61926468 missense probably benign 0.19
IGL00814:Kif23 APN 9 61937107 missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61932129 missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61919900 missense probably damaging 0.99
IGL01583:Kif23 APN 9 61935468 missense probably damaging 1.00
IGL01680:Kif23 APN 9 61931814 missense probably benign 0.17
IGL02450:Kif23 APN 9 61923957 missense probably benign 0.00
IGL02698:Kif23 APN 9 61925001 missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61929776 splice site probably benign
IGL03233:Kif23 APN 9 61926453 missense probably benign 0.05
H8562:Kif23 UTSW 9 61924065 missense probably benign
R0225:Kif23 UTSW 9 61925694 splice site probably benign
R0419:Kif23 UTSW 9 61926405 nonsense probably null
R0512:Kif23 UTSW 9 61918975 splice site probably benign
R0731:Kif23 UTSW 9 61925032 missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61936764 missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61923988 unclassified probably null
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1451:Kif23 UTSW 9 61924802 missense probably damaging 1.00
R1624:Kif23 UTSW 9 61925700 splice site probably null
R1820:Kif23 UTSW 9 61926438 missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61918961 missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61946610 critical splice donor site probably null
R2001:Kif23 UTSW 9 61927384 nonsense probably null
R2002:Kif23 UTSW 9 61927384 nonsense probably null
R2310:Kif23 UTSW 9 61924144 missense probably damaging 1.00
R2680:Kif23 UTSW 9 61937476 missense probably benign 0.25
R3196:Kif23 UTSW 9 61931911 nonsense probably null
R3774:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3775:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3776:Kif23 UTSW 9 61924992 missense probably benign 0.00
R4349:Kif23 UTSW 9 61932114 missense probably damaging 1.00
R4671:Kif23 UTSW 9 61945359 missense probably benign 0.04
R4981:Kif23 UTSW 9 61931871 missense probably damaging 1.00
R4983:Kif23 UTSW 9 61936703 missense probably benign 0.01
R5721:Kif23 UTSW 9 61944216 missense probably benign 0.45
R6903:Kif23 UTSW 9 61927154 missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61924989 missense probably benign 0.01
R7103:Kif23 UTSW 9 61919892 missense probably damaging 0.99
R7456:Kif23 UTSW 9 61937120 missense probably benign 0.09
R7468:Kif23 UTSW 9 61937175 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGCATCGGTTTAACTGCG -3'
(R):5'- CAAAAGTTCCACTGAGTACTAATGG -3'

Sequencing Primer
(F):5'- GCATCGGTTTAACTGCGTGCTC -3'
(R):5'- CATATACCACATTTCTCGAGTACAG -3'
Posted On2016-11-09