Incidental Mutation 'R5685:Slc34a1'
ID443303
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Namesolute carrier family 34 (sodium phosphate), member 1
SynonymsNa/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55398187-55415592 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55401272 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057167] [ENSMUST00000224925] [ENSMUST00000225259]
Predicted Effect probably null
Transcript: ENSMUST00000057167
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
Predicted Effect probably null
Transcript: ENSMUST00000225259
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Slc34a1 APN 13 55409071 missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55402733 missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55412128 missense probably damaging 1.00
IGL02525:Slc34a1 APN 13 55403238 splice site probably benign
IGL02555:Slc34a1 APN 13 55401168 missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55403236 splice site probably benign
IGL03173:Slc34a1 APN 13 55413276 missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55400778 missense probably benign 0.00
R0190:Slc34a1 UTSW 13 55409101 missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55412265 missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55402898 splice site probably null
R1055:Slc34a1 UTSW 13 55403033 missense probably benign 0.26
R1243:Slc34a1 UTSW 13 55412131 missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55400711 missense probably benign
R1566:Slc34a1 UTSW 13 55412031 critical splice acceptor site probably null
R1732:Slc34a1 UTSW 13 55413420 missense probably benign
R1901:Slc34a1 UTSW 13 55401150 nonsense probably null
R2423:Slc34a1 UTSW 13 55409052 missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55403329 missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55413170 missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55402661 splice site probably benign
R4553:Slc34a1 UTSW 13 55412061 synonymous probably null
R4735:Slc34a1 UTSW 13 55413584 missense probably benign 0.13
R5177:Slc34a1 UTSW 13 55401162 missense probably damaging 0.99
R5345:Slc34a1 UTSW 13 55400518 missense probably benign
R5363:Slc34a1 UTSW 13 55403268 missense probably benign 0.16
R5363:Slc34a1 UTSW 13 55412290 missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55409085 missense possibly damaging 0.94
R5782:Slc34a1 UTSW 13 55402688 missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55413465 missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55412071 missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55402682 missense probably benign 0.15
R7158:Slc34a1 UTSW 13 55401231 missense probably damaging 0.99
R7384:Slc34a1 UTSW 13 55402934 missense probably benign 0.00
X0022:Slc34a1 UTSW 13 55403015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTGACACTGGCTTCTGTTC -3'
(R):5'- TTCCTGAGCAATGGTGTGGC -3'

Sequencing Primer
(F):5'- GACACTGGCTTCTGTTCTGCAG -3'
(R):5'- CCTTCCAGGAGCTGTGGTTC -3'
Posted On2016-11-09