Incidental Mutation 'H8562:Osbpl3'
ID44332
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Nameoxysterol binding protein-like 3
Synonyms6720421I08Rik, OSBP3, ORP3, 1200014M06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome6
Chromosomal Location50293330-50456201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50347466 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 190 (N190K)
Ref Sequence ENSEMBL: ENSMUSP00000110112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468] [ENSMUST00000146341] [ENSMUST00000203907]
Predicted Effect probably benign
Transcript: ENSMUST00000071728
AA Change: N190K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: N190K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090019
AA Change: N190K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: N190K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114466
AA Change: N190K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: N190K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114468
AA Change: N190K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: N190K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Predicted Effect probably benign
Transcript: ENSMUST00000146341
SMART Domains Protein: ENSMUSP00000114472
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 144 1.27e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203907
SMART Domains Protein: ENSMUSP00000145249
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
Blast:PH 1 91 1e-57 BLAST
low complexity region 208 241 N/A INTRINSIC
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50323068 missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50344922 missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50327367 unclassified probably benign
IGL02323:Osbpl3 APN 6 50346326 critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50346332 missense possibly damaging 0.89
PIT4283001:Osbpl3 UTSW 6 50346088 missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50353008 missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50348018 missense probably benign
R0417:Osbpl3 UTSW 6 50348018 missense probably benign
R0601:Osbpl3 UTSW 6 50299403 missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50346377 missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50308427 missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50346431 missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50323093 missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50336213 critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50370143 missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50320074 missense probably benign 0.16
R3435:Osbpl3 UTSW 6 50348070 missense possibly damaging 0.94
R3768:Osbpl3 UTSW 6 50348002 missense possibly damaging 0.64
R4746:Osbpl3 UTSW 6 50328674 missense probably damaging 0.99
R4751:Osbpl3 UTSW 6 50300997 missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50300973 missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50353000 missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50309376 missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50352784 missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50336297 missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50309360 missense probably damaging 0.98
R6282:Osbpl3 UTSW 6 50348083 unclassified probably null
R6304:Osbpl3 UTSW 6 50312674 missense probably damaging 1.00
R6905:Osbpl3 UTSW 6 50351882 missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50297157 missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50320135 missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50346430 missense probably benign 0.02
R7334:Osbpl3 UTSW 6 50344906 missense possibly damaging 0.78
R7368:Osbpl3 UTSW 6 50348098 missense probably damaging 1.00
R8052:Osbpl3 UTSW 6 50346015 missense probably damaging 1.00
RF011:Osbpl3 UTSW 6 50348138 critical splice acceptor site probably benign
Z1088:Osbpl3 UTSW 6 50297097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGGTGAAGATGCTAAGCTCTGTG -3'
(R):5'- GCCAGAAGTACCCAAATCTCCTGTG -3'

Sequencing Primer
(F):5'- GCTGATGATGACGAGACCTTC -3'
(R):5'- CTGCCTGGCTCTGTTTTGAT -3'
Posted On2013-06-11