Incidental Mutation 'R5685:Galnt1'
ID443326
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Namepolypeptide N-acetylgalactosaminyltransferase 1
SynonymsppGaNTase-T1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24205344-24286818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24264529 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 229 (D229V)
Ref Sequence ENSEMBL: ENSMUSP00000137427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000170243] [ENSMUST00000171583] [ENSMUST00000178605]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000430
AA Change: D229V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: D229V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164066
SMART Domains Protein: ENSMUSP00000130238
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
PDB:2D7R|A 2 44 6e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000170243
AA Change: D229V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: D229V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171583
SMART Domains Protein: ENSMUSP00000131755
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178605
AA Change: D229V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: D229V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24267560 missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24280035 missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24264412 missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24269517 missense probably damaging 0.99
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24254525 missense probably benign 0.01
R1183:Galnt1 UTSW 18 24271590 missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24271774 splice site probably benign
R2349:Galnt1 UTSW 18 24280028 missense probably benign 0.03
R3739:Galnt1 UTSW 18 24271655 missense probably benign 0.27
R4223:Galnt1 UTSW 18 24238356 missense probably benign 0.27
R5001:Galnt1 UTSW 18 24271755 missense probably benign
R5410:Galnt1 UTSW 18 24267547 missense probably benign 0.02
R5516:Galnt1 UTSW 18 24280017 missense probably benign 0.00
R5687:Galnt1 UTSW 18 24272750 missense probably benign 0.00
R5735:Galnt1 UTSW 18 24264520 missense possibly damaging 0.64
R6106:Galnt1 UTSW 18 24254663 missense probably benign 0.31
R6222:Galnt1 UTSW 18 24264534 critical splice donor site probably null
R7448:Galnt1 UTSW 18 24284809 missense probably benign 0.00
R7489:Galnt1 UTSW 18 24282157 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGAAAGTGCCGGTTCATG -3'
(R):5'- CCATTTGGTCAACAGAGCATG -3'

Sequencing Primer
(F):5'- CTGAAAGTGCCGGTTCATGTAATTC -3'
(R):5'- GCAAATGTGTTAACTGCCAGAC -3'
Posted On2016-11-09