Incidental Mutation 'R5686:Esrrg'
ID 443333
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Name estrogen-related receptor gamma
Synonyms ERR3, estrogen-related receptor 3, NR3B3, Errg
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 187608791-188214885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 188150198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 217 (H217Q)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]
AlphaFold P62509
Predicted Effect probably benign
Transcript: ENSMUST00000027906
AA Change: H240Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: H240Q

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110938
AA Change: H217Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: H217Q

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110939
AA Change: H217Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: H217Q

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 188210910 missense probably damaging 1.00
IGL01635:Esrrg APN 1 188198600 missense probably damaging 1.00
IGL01642:Esrrg APN 1 188210915 missense probably benign 0.01
IGL02740:Esrrg APN 1 188198741 missense probably benign 0.04
IGL03126:Esrrg APN 1 187997987 intron probably benign
IGL03391:Esrrg APN 1 188150223 missense possibly damaging 0.70
R0395:Esrrg UTSW 1 188198635 missense probably damaging 1.00
R0645:Esrrg UTSW 1 188043341 missense probably benign 0.00
R1593:Esrrg UTSW 1 188066385 missense possibly damaging 0.94
R1700:Esrrg UTSW 1 188043653 missense probably damaging 1.00
R1855:Esrrg UTSW 1 188211098 missense probably damaging 1.00
R3552:Esrrg UTSW 1 188150190 missense probably benign 0.05
R3605:Esrrg UTSW 1 188211102 missense possibly damaging 0.74
R4384:Esrrg UTSW 1 188043711 missense probably damaging 1.00
R5255:Esrrg UTSW 1 188146358 missense probably damaging 1.00
R5443:Esrrg UTSW 1 188043425 missense possibly damaging 0.78
R5511:Esrrg UTSW 1 188211107 missense probably damaging 1.00
R5516:Esrrg UTSW 1 188198730 missense possibly damaging 0.56
R5543:Esrrg UTSW 1 188150254 missense probably damaging 0.96
R5990:Esrrg UTSW 1 188198798 missense probably damaging 1.00
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R7058:Esrrg UTSW 1 188150306 missense probably damaging 1.00
R7487:Esrrg UTSW 1 188146423 missense probably benign 0.03
R8512:Esrrg UTSW 1 188043580 nonsense probably null
R8735:Esrrg UTSW 1 188201008 intron probably benign
R8973:Esrrg UTSW 1 188198750 missense possibly damaging 0.79
R8986:Esrrg UTSW 1 188210907 missense possibly damaging 0.60
R9114:Esrrg UTSW 1 188146408 missense probably benign 0.01
R9114:Esrrg UTSW 1 188146409 missense possibly damaging 0.75
R9483:Esrrg UTSW 1 188198651 missense probably damaging 0.97
R9760:Esrrg UTSW 1 188043372 missense probably benign
Z1088:Esrrg UTSW 1 188150218 missense probably benign 0.04
Z1177:Esrrg UTSW 1 188043555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCGCACAGGGTGTAC -3'
(R):5'- TGCAGAGTTAAGTGCAGACAAC -3'

Sequencing Primer
(F):5'- CAGGGTGTACCATGGTGGAGTAC -3'
(R):5'- AGGCACCTGCAGTCTTTG -3'
Posted On 2016-11-09