Incidental Mutation 'R5686:Esrrg'
ID 443333
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Name estrogen-related receptor gamma
Synonyms ERR3, estrogen-related receptor 3, Errg, NR3B3
MMRRC Submission 043319-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 187340988-187947082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 187882395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 217 (H217Q)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]
AlphaFold P62509
Predicted Effect probably benign
Transcript: ENSMUST00000027906
AA Change: H240Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: H240Q

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110938
AA Change: H217Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: H217Q

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110939
AA Change: H217Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: H217Q

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,451,433 (GRCm39) E839G possibly damaging Het
Adgrf3 T A 5: 30,402,304 (GRCm39) T575S probably damaging Het
Akap9 T A 5: 4,021,926 (GRCm39) C1158S probably benign Het
Arhgap39 A G 15: 76,610,833 (GRCm39) F926L probably damaging Het
BC035947 G T 1: 78,474,567 (GRCm39) T655K probably benign Het
Bcas1 T C 2: 170,248,730 (GRCm39) T64A probably benign Het
Bltp1 T A 3: 36,971,809 (GRCm39) F514Y probably benign Het
Brca2 A G 5: 150,464,369 (GRCm39) K1378E probably benign Het
Card6 A T 15: 5,130,435 (GRCm39) N320K probably damaging Het
Ccdc3 A T 2: 5,142,871 (GRCm39) I43F probably damaging Het
Cd200r1 T C 16: 44,610,527 (GRCm39) S212P probably damaging Het
Cdh8 T C 8: 99,759,854 (GRCm39) I632V probably benign Het
Col25a1 A G 3: 130,357,803 (GRCm39) E477G probably damaging Het
Cpne5 A T 17: 29,402,991 (GRCm39) C215S possibly damaging Het
Crim1 T A 17: 78,681,512 (GRCm39) S989T possibly damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dync1h1 T A 12: 110,582,838 (GRCm39) N340K probably benign Het
Eif4e2 G A 1: 87,153,960 (GRCm39) probably null Het
Ephb6 G T 6: 41,596,638 (GRCm39) R895L possibly damaging Het
Fgl1 T A 8: 41,653,594 (GRCm39) K100* probably null Het
Flt4 T C 11: 49,521,430 (GRCm39) V450A probably benign Het
G6pc2 A T 2: 69,051,128 (GRCm39) I74L probably benign Het
Gabrr1 T C 4: 33,161,684 (GRCm39) M336T probably damaging Het
Gli1 T A 10: 127,173,305 (GRCm39) T118S probably benign Het
Gm5435 A T 12: 82,542,800 (GRCm39) noncoding transcript Het
Got1l1 A G 8: 27,688,087 (GRCm39) L314P probably damaging Het
Hk3 T A 13: 55,154,626 (GRCm39) I740F probably damaging Het
Htr7 C A 19: 35,947,271 (GRCm39) A248S probably damaging Het
Igsf9b A G 9: 27,235,475 (GRCm39) T508A probably damaging Het
Il16 T A 7: 83,297,936 (GRCm39) N431I probably benign Het
Lax1 G A 1: 133,607,914 (GRCm39) P276S probably damaging Het
Lrp2 A T 2: 69,341,405 (GRCm39) V925E possibly damaging Het
Lrp3 T A 7: 34,902,910 (GRCm39) T479S possibly damaging Het
Metrn G A 17: 26,014,191 (GRCm39) R212C probably damaging Het
Mlip A C 9: 77,254,975 (GRCm39) probably null Het
Mmp24 C T 2: 155,641,697 (GRCm39) T175I probably damaging Het
N6amt1 A T 16: 87,151,223 (GRCm39) D28V probably damaging Het
Or1e21 A T 11: 73,344,677 (GRCm39) Y120* probably null Het
Or4f4b G A 2: 111,314,488 (GRCm39) G238R probably damaging Het
Or5p52 A G 7: 107,502,119 (GRCm39) H65R probably damaging Het
Or5p66 G T 7: 107,885,949 (GRCm39) A128E probably damaging Het
Or6d15 T C 6: 116,559,890 (GRCm39) T6A probably benign Het
Or8b12i T A 9: 20,082,265 (GRCm39) I201F possibly damaging Het
Pcdh17 T A 14: 84,770,433 (GRCm39) N970K probably damaging Het
Pdzrn3 T C 6: 101,128,389 (GRCm39) Y759C probably damaging Het
Pkd2l2 T C 18: 34,558,290 (GRCm39) L323P probably damaging Het
Psg21 G T 7: 18,386,183 (GRCm39) probably benign Het
Rest T C 5: 77,429,573 (GRCm39) V664A probably benign Het
Sco2 G A 15: 89,256,175 (GRCm39) R160* probably null Het
Sfswap T A 5: 129,591,882 (GRCm39) S300T probably damaging Het
Slc5a10 A T 11: 61,569,392 (GRCm39) M329K probably benign Het
Slco1a5 G A 6: 142,182,033 (GRCm39) P564S probably damaging Het
Stk38 A G 17: 29,201,103 (GRCm39) F191S probably damaging Het
Svep1 T A 4: 58,072,826 (GRCm39) Y2161F possibly damaging Het
Tada2a G A 11: 83,970,428 (GRCm39) T441M possibly damaging Het
Tg T A 15: 66,560,738 (GRCm39) N1033K probably benign Het
Thoc3 A T 13: 54,615,686 (GRCm39) I126N probably damaging Het
Tnc T C 4: 63,925,967 (GRCm39) probably null Het
Tnc A T 4: 63,927,032 (GRCm39) D831E possibly damaging Het
Uhmk1 A T 1: 170,038,787 (GRCm39) V100E probably damaging Het
Usp43 G A 11: 67,812,742 (GRCm39) probably benign Het
Vmn2r90 A T 17: 17,933,712 (GRCm39) Y424F probably benign Het
Vps33a C T 5: 123,685,064 (GRCm39) probably null Het
Xirp2 A T 2: 67,312,642 (GRCm39) K37I probably damaging Het
Zfp106 A T 2: 120,363,988 (GRCm39) probably null Het
Zfp748 A T 13: 67,690,647 (GRCm39) C204* probably null Het
Zfp998 T C 13: 66,579,722 (GRCm39) R254G probably benign Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 187,943,107 (GRCm39) missense probably damaging 1.00
IGL01635:Esrrg APN 1 187,930,797 (GRCm39) missense probably damaging 1.00
IGL01642:Esrrg APN 1 187,943,112 (GRCm39) missense probably benign 0.01
IGL02740:Esrrg APN 1 187,930,938 (GRCm39) missense probably benign 0.04
IGL03126:Esrrg APN 1 187,730,184 (GRCm39) intron probably benign
IGL03391:Esrrg APN 1 187,882,420 (GRCm39) missense possibly damaging 0.70
R0395:Esrrg UTSW 1 187,930,832 (GRCm39) missense probably damaging 1.00
R0645:Esrrg UTSW 1 187,775,538 (GRCm39) missense probably benign 0.00
R1593:Esrrg UTSW 1 187,798,582 (GRCm39) missense possibly damaging 0.94
R1700:Esrrg UTSW 1 187,775,850 (GRCm39) missense probably damaging 1.00
R1855:Esrrg UTSW 1 187,943,295 (GRCm39) missense probably damaging 1.00
R3552:Esrrg UTSW 1 187,882,387 (GRCm39) missense probably benign 0.05
R3605:Esrrg UTSW 1 187,943,299 (GRCm39) missense possibly damaging 0.74
R4384:Esrrg UTSW 1 187,775,908 (GRCm39) missense probably damaging 1.00
R5255:Esrrg UTSW 1 187,878,555 (GRCm39) missense probably damaging 1.00
R5443:Esrrg UTSW 1 187,775,622 (GRCm39) missense possibly damaging 0.78
R5511:Esrrg UTSW 1 187,943,304 (GRCm39) missense probably damaging 1.00
R5516:Esrrg UTSW 1 187,930,927 (GRCm39) missense possibly damaging 0.56
R5543:Esrrg UTSW 1 187,882,451 (GRCm39) missense probably damaging 0.96
R5990:Esrrg UTSW 1 187,930,995 (GRCm39) missense probably damaging 1.00
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R7058:Esrrg UTSW 1 187,882,503 (GRCm39) missense probably damaging 1.00
R7487:Esrrg UTSW 1 187,878,620 (GRCm39) missense probably benign 0.03
R8512:Esrrg UTSW 1 187,775,777 (GRCm39) nonsense probably null
R8735:Esrrg UTSW 1 187,933,205 (GRCm39) intron probably benign
R8973:Esrrg UTSW 1 187,930,947 (GRCm39) missense possibly damaging 0.79
R8986:Esrrg UTSW 1 187,943,104 (GRCm39) missense possibly damaging 0.60
R9114:Esrrg UTSW 1 187,878,606 (GRCm39) missense possibly damaging 0.75
R9114:Esrrg UTSW 1 187,878,605 (GRCm39) missense probably benign 0.01
R9483:Esrrg UTSW 1 187,930,848 (GRCm39) missense probably damaging 0.97
R9760:Esrrg UTSW 1 187,775,569 (GRCm39) missense probably benign
Z1088:Esrrg UTSW 1 187,882,415 (GRCm39) missense probably benign 0.04
Z1177:Esrrg UTSW 1 187,775,752 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCGCACAGGGTGTAC -3'
(R):5'- TGCAGAGTTAAGTGCAGACAAC -3'

Sequencing Primer
(F):5'- CAGGGTGTACCATGGTGGAGTAC -3'
(R):5'- AGGCACCTGCAGTCTTTG -3'
Posted On 2016-11-09