Incidental Mutation 'R5686:Mmp24'
ID 443339
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Name matrix metallopeptidase 24
Synonyms Membrane type 5-MMP, MT5-MMP
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155775342-155818366 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 155799777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 175 (T175I)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141]
AlphaFold Q9R0S2
Predicted Effect probably damaging
Transcript: ENSMUST00000029141
AA Change: T175I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: T175I

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Meta Mutation Damage Score 0.4185 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155799887 missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155812293 missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155815788 missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155792597 missense probably benign 0.01
R1381:Mmp24 UTSW 2 155814127 missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4498:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155815899 missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155814096 missense probably damaging 0.99
R5020:Mmp24 UTSW 2 155810284 missense probably benign 0.09
R5501:Mmp24 UTSW 2 155798136 missense probably damaging 1.00
R5709:Mmp24 UTSW 2 155792542 missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155799909 missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155815753 missense possibly damaging 0.67
R6657:Mmp24 UTSW 2 155798179 missense probably damaging 1.00
R7015:Mmp24 UTSW 2 155792624 missense probably damaging 0.99
R7699:Mmp24 UTSW 2 155798176 missense probably damaging 0.99
R8076:Mmp24 UTSW 2 155807561 nonsense probably null
R8111:Mmp24 UTSW 2 155807425 missense possibly damaging 0.81
R8139:Mmp24 UTSW 2 155814045 nonsense probably null
R8304:Mmp24 UTSW 2 155799839 missense possibly damaging 0.85
R8344:Mmp24 UTSW 2 155810303 missense possibly damaging 0.68
R8411:Mmp24 UTSW 2 155814015 missense probably benign 0.03
R8527:Mmp24 UTSW 2 155799714 missense probably benign 0.02
R8542:Mmp24 UTSW 2 155799714 missense probably benign 0.02
R9198:Mmp24 UTSW 2 155798121 missense probably benign 0.19
R9500:Mmp24 UTSW 2 155812275 missense probably damaging 1.00
Z1176:Mmp24 UTSW 2 155810392 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCTGAAGCATCTCAGTAG -3'
(R):5'- AAGTGAGTGTCTCCTCCGATC -3'

Sequencing Primer
(F):5'- TGTGAAGACCACTGGACCATACTTC -3'
(R):5'- AGTGTCTCCTCCGATCCCTGG -3'
Posted On 2016-11-09