Mutagenetix > Incidental Mutation

Incidental Mutation 'R5686:Gabrr1'

443343

Institutional Source

Beutler Lab

Gene Symbol

Gabrr1

Ensembl Gene

ENSMUSG00000028280

Gene Name

gamma-aminobutyric acid (GABA) C receptor, subunit rho 1

Synonyms

GABA-C

MMRRC Submission

043319-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5686 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33132521-33163588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33161684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 336 (M336T)

Ref Sequence

ENSEMBL: ENSMUSP00000029947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029947]

AlphaFold

P56475

Predicted Effect

probably damaging
Transcript: ENSMUST00000029947
AA Change: M336T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029947
Gene: ENSMUSG00000028280
AA Change: M336T

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	69	276	4.8e-53	PFAM
Pfam:Neur_chan_memb	283	402	3.1e-33	PFAM
transmembrane domain	453	472	N/A	INTRINSIC

Meta Mutation Damage Score

0.7292

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display altered visual processing in the retina. Mice homozygous for a different knock-out allele exhibit alterations of mechanical pain sensitivity, GABA-inhibited spinal cord responses, and olfactory function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,303,314	E839G	possibly damaging	Het
2410141K09Rik	T	C	13: 66,431,663	R254G	probably benign	Het
4932438A13Rik	T	A	3: 36,917,660	F514Y	probably benign	Het
Adgrf3	T	A	5: 30,197,306	T575S	probably damaging	Het
Akap9	T	A	5: 3,971,926	C1158S	probably benign	Het
Arhgap39	A	G	15: 76,726,633	F926L	probably damaging	Het
BC035947	G	T	1: 78,497,930	T655K	probably benign	Het
Bcas1	T	C	2: 170,406,810	T64A	probably benign	Het
Brca2	A	G	5: 150,540,904	K1378E	probably benign	Het
Card6	A	T	15: 5,100,953	N320K	probably damaging	Het
Ccdc3	A	T	2: 5,138,060	I43F	probably damaging	Het
Cd200r1	T	C	16: 44,790,164	S212P	probably damaging	Het
Cdh8	T	C	8: 99,033,222	I632V	probably benign	Het
Col25a1	A	G	3: 130,564,154	E477G	probably damaging	Het
Cpne5	A	T	17: 29,184,017	C215S	possibly damaging	Het
Crim1	T	A	17: 78,374,083	S989T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dync1h1	T	A	12: 110,616,404	N340K	probably benign	Het
Eif4e2	G	A	1: 87,226,238		probably null	Het
Ephb6	G	T	6: 41,619,704	R895L	possibly damaging	Het
Esrrg	T	A	1: 188,150,198	H217Q	probably benign	Het
Fgl1	T	A	8: 41,200,557	K100*	probably null	Het
Flt4	T	C	11: 49,630,603	V450A	probably benign	Het
G6pc2	A	T	2: 69,220,784	I74L	probably benign	Het
Gli1	T	A	10: 127,337,436	T118S	probably benign	Het
Gm5435	A	T	12: 82,496,026		noncoding transcript	Het
Got1l1	A	G	8: 27,198,059	L314P	probably damaging	Het
Hk3	T	A	13: 55,006,813	I740F	probably damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Igsf9b	A	G	9: 27,324,179	T508A	probably damaging	Het
Il16	T	A	7: 83,648,728	N431I	probably benign	Het
Lax1	G	A	1: 133,680,176	P276S	probably damaging	Het
Lrp2	A	T	2: 69,511,061	V925E	possibly damaging	Het
Lrp3	T	A	7: 35,203,485	T479S	possibly damaging	Het
Metrn	G	A	17: 25,795,217	R212C	probably damaging	Het
Mlip	A	C	9: 77,347,693		probably null	Het
Mmp24	C	T	2: 155,799,777	T175I	probably damaging	Het
N6amt1	A	T	16: 87,354,335	D28V	probably damaging	Het
Olfr1289	G	A	2: 111,484,143	G238R	probably damaging	Het
Olfr215	T	C	6: 116,582,929	T6A	probably benign	Het
Olfr380	A	T	11: 73,453,851	Y120*	probably null	Het
Olfr472	A	G	7: 107,902,912	H65R	probably damaging	Het
Olfr490	G	T	7: 108,286,742	A128E	probably damaging	Het
Olfr870	T	A	9: 20,170,969	I201F	possibly damaging	Het
Pcdh17	T	A	14: 84,532,993	N970K	probably damaging	Het
Pdzrn3	T	C	6: 101,151,428	Y759C	probably damaging	Het
Pkd2l2	T	C	18: 34,425,237	L323P	probably damaging	Het
Psg21	G	T	7: 18,652,258		probably benign	Het
Rest	T	C	5: 77,281,726	V664A	probably benign	Het
Sco2	G	A	15: 89,371,972	R160*	probably null	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc5a10	A	T	11: 61,678,566	M329K	probably benign	Het
Slco1a5	G	A	6: 142,236,307	P564S	probably damaging	Het
Stk38	A	G	17: 28,982,129	F191S	probably damaging	Het
Svep1	T	A	4: 58,072,826	Y2161F	possibly damaging	Het
Tada2a	G	A	11: 84,079,602	T441M	possibly damaging	Het
Tg	T	A	15: 66,688,889	N1033K	probably benign	Het
Thoc3	A	T	13: 54,467,873	I126N	probably damaging	Het
Tnc	T	C	4: 64,007,730		probably null	Het
Tnc	A	T	4: 64,008,795	D831E	possibly damaging	Het
Uhmk1	A	T	1: 170,211,218	V100E	probably damaging	Het
Usp43	G	A	11: 67,921,916		probably benign	Het
Vmn2r90	A	T	17: 17,713,450	Y424F	probably benign	Het
Vps33a	C	T	5: 123,547,001		probably null	Het
Xirp2	A	T	2: 67,482,298	K37I	probably damaging	Het
Zfp106	A	T	2: 120,533,507		probably null	Het
Zfp748	A	T	13: 67,542,528	C204*	probably null	Het

Other mutations in Gabrr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01617:Gabrr1	APN	4	33162634	missense	probably benign
IGL02052:Gabrr1	APN	4	33152567	missense	probably damaging	0.98
IGL02169:Gabrr1	APN	4	33160261	missense	probably damaging	1.00
IGL02834:Gabrr1	APN	4	33151426	missense	probably damaging	1.00
PIT4498001:Gabrr1	UTSW	4	33160225	missense	probably damaging	1.00
R0135:Gabrr1	UTSW	4	33160224	missense	probably damaging	1.00
R0606:Gabrr1	UTSW	4	33132696	missense	probably benign	0.30
R0739:Gabrr1	UTSW	4	33162781	missense	probably benign	0.08
R0843:Gabrr1	UTSW	4	33161717	missense	possibly damaging	0.93
R1182:Gabrr1	UTSW	4	33132680	missense	probably benign
R1628:Gabrr1	UTSW	4	33152432	missense	probably damaging	1.00
R1724:Gabrr1	UTSW	4	33161651	missense	probably damaging	0.98
R2300:Gabrr1	UTSW	4	33152449	missense	probably benign	0.01
R2405:Gabrr1	UTSW	4	33157110	missense	probably damaging	1.00
R3424:Gabrr1	UTSW	4	33158058	missense	probably damaging	1.00
R3500:Gabrr1	UTSW	4	33158184	splice site	probably benign
R4575:Gabrr1	UTSW	4	33158175	missense	possibly damaging	0.94
R4923:Gabrr1	UTSW	4	33162820	missense	possibly damaging	0.59
R5941:Gabrr1	UTSW	4	33162676	missense	probably benign	0.01
R6122:Gabrr1	UTSW	4	33161695	missense	probably damaging	1.00
R6217:Gabrr1	UTSW	4	33149026	splice site	probably null
R6232:Gabrr1	UTSW	4	33161632	missense	probably benign	0.41
R6489:Gabrr1	UTSW	4	33162855	missense	probably benign	0.02
R6793:Gabrr1	UTSW	4	33162712	missense	possibly damaging	0.66
R6996:Gabrr1	UTSW	4	33158157	missense	probably damaging	0.96
R7396:Gabrr1	UTSW	4	33160207	missense	probably damaging	1.00
R7465:Gabrr1	UTSW	4	33146970	missense	probably benign
R7597:Gabrr1	UTSW	4	33148964	missense	probably benign	0.17
R8170:Gabrr1	UTSW	4	33162718	missense	probably damaging	1.00
R8418:Gabrr1	UTSW	4	33162615	nonsense	probably null
R8795:Gabrr1	UTSW	4	33161756	missense	probably damaging	0.98
R8933:Gabrr1	UTSW	4	33146972	missense	probably benign
R8966:Gabrr1	UTSW	4	33152411	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGTGCTAAATGTCTAGGC -3'
(R):5'- TCAGCTGAGGAGAGGGTATC -3'

Sequencing Primer
(F):5'- TGCTAAATGTCTAGGCCAAGG -3'
(R):5'- GGGTATCACAGCCTCATTTTACAGG -3'

Posted On

2016-11-09