Mutagenetix > Incidental Mutations

Incidental Mutation 'R5686:Tnc'

443345

Institutional Source

Beutler Lab

Gene Symbol

Tnc

Ensembl Gene

ENSMUSG00000028364

Gene Name

tenascin C

Synonyms

TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb

MMRRC Submission

043319-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5686 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

63959785-64047015 bp(-) (GRCm38)

Type of Mutation

unclassified (4939 bp from exon)

DNA Base Change (assembly)

T to C at 64007730 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]

Predicted Effect

probably benign
Transcript: ENSMUST00000030056
AA Change: I938V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: I938V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107371

SMART Domains

Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
Pfam:hEGF	173	185	4e-4	PFAM
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107372
AA Change: I938V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: I938V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	2.75e0	SMART
FN3	1529	1608	3.4e-4	SMART
FN3	1619	1697	1.55e-7	SMART
FN3	1708	1785	1.53e-6	SMART
FN3	1796	1873	7.75e-8	SMART
FBG	1888	2098	4.08e-124	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107377
AA Change: I938V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: I938V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141428

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,303,314	E839G	possibly damaging	Het
2410141K09Rik	T	C	13: 66,431,663	R254G	probably benign	Het
4932438A13Rik	T	A	3: 36,917,660	F514Y	probably benign	Het
Adgrf3	T	A	5: 30,197,306	T575S	probably damaging	Het
Akap9	T	A	5: 3,971,926	C1158S	probably benign	Het
Arhgap39	A	G	15: 76,726,633	F926L	probably damaging	Het
BC035947	G	T	1: 78,497,930	T655K	probably benign	Het
Bcas1	T	C	2: 170,406,810	T64A	probably benign	Het
Brca2	A	G	5: 150,540,904	K1378E	probably benign	Het
Card6	A	T	15: 5,100,953	N320K	probably damaging	Het
Ccdc3	A	T	2: 5,138,060	I43F	probably damaging	Het
Cd200r1	T	C	16: 44,790,164	S212P	probably damaging	Het
Cdh8	T	C	8: 99,033,222	I632V	probably benign	Het
Col25a1	A	G	3: 130,564,154	E477G	probably damaging	Het
Cpne5	A	T	17: 29,184,017	C215S	possibly damaging	Het
Crim1	T	A	17: 78,374,083	S989T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dync1h1	T	A	12: 110,616,404	N340K	probably benign	Het
Eif4e2	G	A	1: 87,226,238		probably null	Het
Ephb6	G	T	6: 41,619,704	R895L	possibly damaging	Het
Esrrg	T	A	1: 188,150,198	H217Q	probably benign	Het
Fgl1	T	A	8: 41,200,557	K100*	probably null	Het
Flt4	T	C	11: 49,630,603	V450A	probably benign	Het
G6pc2	A	T	2: 69,220,784	I74L	probably benign	Het
Gabrr1	T	C	4: 33,161,684	M336T	probably damaging	Het
Gli1	T	A	10: 127,337,436	T118S	probably benign	Het
Gm5435	A	T	12: 82,496,026		noncoding transcript	Het
Got1l1	A	G	8: 27,198,059	L314P	probably damaging	Het
Hk3	T	A	13: 55,006,813	I740F	probably damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Igsf9b	A	G	9: 27,324,179	T508A	probably damaging	Het
Il16	T	A	7: 83,648,728	N431I	probably benign	Het
Lax1	G	A	1: 133,680,176	P276S	probably damaging	Het
Lrp2	A	T	2: 69,511,061	V925E	possibly damaging	Het
Lrp3	T	A	7: 35,203,485	T479S	possibly damaging	Het
Metrn	G	A	17: 25,795,217	R212C	probably damaging	Het
Mlip	A	C	9: 77,347,693		probably null	Het
Mmp24	C	T	2: 155,799,777	T175I	probably damaging	Het
N6amt1	A	T	16: 87,354,335	D28V	probably damaging	Het
Olfr1289	G	A	2: 111,484,143	G238R	probably damaging	Het
Olfr215	T	C	6: 116,582,929	T6A	probably benign	Het
Olfr380	A	T	11: 73,453,851	Y120*	probably null	Het
Olfr472	A	G	7: 107,902,912	H65R	probably damaging	Het
Olfr490	G	T	7: 108,286,742	A128E	probably damaging	Het
Olfr870	T	A	9: 20,170,969	I201F	possibly damaging	Het
Pcdh17	T	A	14: 84,532,993	N970K	probably damaging	Het
Pdzrn3	T	C	6: 101,151,428	Y759C	probably damaging	Het
Pkd2l2	T	C	18: 34,425,237	L323P	probably damaging	Het
Psg21	G	T	7: 18,652,258		probably benign	Het
Rest	T	C	5: 77,281,726	V664A	probably benign	Het
Sco2	G	A	15: 89,371,972	R160*	probably null	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc5a10	A	T	11: 61,678,566	M329K	probably benign	Het
Slco1a5	G	A	6: 142,236,307	P564S	probably damaging	Het
Stk38	A	G	17: 28,982,129	F191S	probably damaging	Het
Svep1	T	A	4: 58,072,826	Y2161F	possibly damaging	Het
Tada2a	G	A	11: 84,079,602	T441M	possibly damaging	Het
Tg	T	A	15: 66,688,889	N1033K	probably benign	Het
Thoc3	A	T	13: 54,467,873	I126N	probably damaging	Het
Uhmk1	A	T	1: 170,211,218	V100E	probably damaging	Het
Usp43	G	A	11: 67,921,916		probably benign	Het
Vmn2r90	A	T	17: 17,713,450	Y424F	probably benign	Het
Vps33a	C	T	5: 123,547,001		probably null	Het
Xirp2	A	T	2: 67,482,298	K37I	probably damaging	Het
Zfp106	A	T	2: 120,533,507		probably null	Het
Zfp748	A	T	13: 67,542,528	C204*	probably null	Het

Other mutations in Tnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Tnc	APN	4	64016824	splice site	probably benign
IGL00531:Tnc	APN	4	63971153	splice site	probably benign
IGL00674:Tnc	APN	4	63965607	missense	probably damaging	1.00
IGL01015:Tnc	APN	4	64017334	missense	probably benign	0.19
IGL01090:Tnc	APN	4	64000080	missense	probably damaging	1.00
IGL01310:Tnc	APN	4	64013077	missense	probably benign	0.03
IGL01331:Tnc	APN	4	63982875	missense	probably damaging	0.99
IGL01393:Tnc	APN	4	64014054	splice site	probably benign
IGL01411:Tnc	APN	4	64000722	missense	probably damaging	0.96
IGL01472:Tnc	APN	4	64006419	missense	probably benign	0.00
IGL01552:Tnc	APN	4	63970408	missense	probably damaging	1.00
IGL01661:Tnc	APN	4	63970307	splice site	probably benign
IGL01669:Tnc	APN	4	64000701	missense	probably damaging	1.00
IGL01912:Tnc	APN	4	64008740	missense	probably damaging	1.00
IGL02028:Tnc	APN	4	63966672	splice site	probably benign
IGL02100:Tnc	APN	4	64000161	missense	possibly damaging	0.84
IGL02549:Tnc	APN	4	64015072	missense	probably damaging	1.00
IGL02642:Tnc	APN	4	63965579	splice site	probably benign
IGL02712:Tnc	APN	4	63975256	missense	probably damaging	1.00
IGL02876:Tnc	APN	4	64015101	missense	possibly damaging	0.56
IGL02886:Tnc	APN	4	64000107	missense	probably damaging	0.96
IGL02972:Tnc	APN	4	63976478	missense	probably benign	0.11
IGL03073:Tnc	APN	4	63971224	missense	possibly damaging	0.58
IGL03116:Tnc	APN	4	64014033	missense	probably damaging	1.00
IGL03181:Tnc	APN	4	63967306	missense	possibly damaging	0.95
IGL03358:Tnc	APN	4	64017615	nonsense	probably null
tancredo	UTSW	4	63993297	nonsense	probably null
P0020:Tnc	UTSW	4	64008857	missense	possibly damaging	0.63
PIT4377001:Tnc	UTSW	4	64017736	missense	probably damaging	1.00
PIT4403001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
PIT4468001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
R0243:Tnc	UTSW	4	63970420	missense	probably damaging	0.98
R0362:Tnc	UTSW	4	64017442	missense	probably damaging	1.00
R0410:Tnc	UTSW	4	64007694	missense	probably benign	0.00
R0420:Tnc	UTSW	4	64000159	missense	probably benign	0.00
R0540:Tnc	UTSW	4	64020455	missense	probably damaging	1.00
R0650:Tnc	UTSW	4	64008734	missense	probably benign	0.00
R1019:Tnc	UTSW	4	63962082	missense	probably damaging	1.00
R1102:Tnc	UTSW	4	64020468	missense	probably benign	0.05
R1126:Tnc	UTSW	4	64018120	missense	probably damaging	0.99
R1141:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1142:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1307:Tnc	UTSW	4	64008859	missense	probably damaging	0.98
R1322:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1414:Tnc	UTSW	4	63965695	splice site	probably benign
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1499:Tnc	UTSW	4	63964754	missense	probably benign	0.15
R1506:Tnc	UTSW	4	64007684	missense	possibly damaging	0.90
R1597:Tnc	UTSW	4	64006384	missense	probably benign
R1750:Tnc	UTSW	4	63972735	missense	probably damaging	1.00
R1765:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1783:Tnc	UTSW	4	64018096	missense	probably damaging	0.98
R1808:Tnc	UTSW	4	63999931	missense	probably damaging	1.00
R1903:Tnc	UTSW	4	64000062	missense	probably benign	0.00
R1932:Tnc	UTSW	4	63993025	critical splice donor site	probably null
R1941:Tnc	UTSW	4	64014964	missense	probably damaging	1.00
R1983:Tnc	UTSW	4	63984630	missense	possibly damaging	0.95
R2024:Tnc	UTSW	4	63964621	missense	probably damaging	1.00
R2075:Tnc	UTSW	4	63995666	missense	possibly damaging	0.94
R2327:Tnc	UTSW	4	63975238	missense	possibly damaging	0.78
R2444:Tnc	UTSW	4	64014963	missense	probably damaging	1.00
R2982:Tnc	UTSW	4	64020519	missense	possibly damaging	0.81
R3874:Tnc	UTSW	4	64008710	missense	probably damaging	1.00
R4110:Tnc	UTSW	4	64014951	missense	probably damaging	1.00
R4360:Tnc	UTSW	4	64016924	missense	probably benign	0.35
R4371:Tnc	UTSW	4	63970351	missense	probably damaging	1.00
R4434:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4438:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4570:Tnc	UTSW	4	63995672	missense	probably damaging	0.99
R4595:Tnc	UTSW	4	63995745	missense	probably damaging	1.00
R4749:Tnc	UTSW	4	63995639	missense	possibly damaging	0.56
R4756:Tnc	UTSW	4	63967343	missense	probably damaging	0.99
R4824:Tnc	UTSW	4	64017620	nonsense	probably null
R4957:Tnc	UTSW	4	63976556	missense	probably damaging	1.00
R4977:Tnc	UTSW	4	64006248	missense	possibly damaging	0.82
R5001:Tnc	UTSW	4	63984489	missense	probably damaging	1.00
R5001:Tnc	UTSW	4	64000062	missense	probably benign	0.16
R5015:Tnc	UTSW	4	64006502	missense	probably damaging	1.00
R5049:Tnc	UTSW	4	64017986	missense	probably damaging	1.00
R5066:Tnc	UTSW	4	63975229	missense	probably damaging	0.96
R5073:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R5116:Tnc	UTSW	4	63967215	critical splice donor site	probably null
R5195:Tnc	UTSW	4	63967252	missense	probably damaging	1.00
R5200:Tnc	UTSW	4	63971278	missense	probably damaging	1.00
R5221:Tnc	UTSW	4	63993297	nonsense	probably null
R5237:Tnc	UTSW	4	63962096	missense	probably damaging	1.00
R5265:Tnc	UTSW	4	63993206	missense	probably benign	0.00
R5275:Tnc	UTSW	4	63964730	nonsense	probably null
R5346:Tnc	UTSW	4	64008655	missense	probably benign
R5409:Tnc	UTSW	4	63966536	missense	probably damaging	1.00
R5409:Tnc	UTSW	4	64007417	missense	probably damaging	1.00
R5469:Tnc	UTSW	4	64013925	splice site	probably null
R5518:Tnc	UTSW	4	64017679	missense	probably damaging	1.00
R5560:Tnc	UTSW	4	64008709	missense	probably damaging	1.00
R5588:Tnc	UTSW	4	64006422	missense	possibly damaging	0.57
R5686:Tnc	UTSW	4	64008795	missense	possibly damaging	0.78
R5837:Tnc	UTSW	4	64013214	missense	probably damaging	1.00
R5976:Tnc	UTSW	4	64018166	missense	probably benign	0.17
R6156:Tnc	UTSW	4	63970352	missense	probably damaging	1.00
R6182:Tnc	UTSW	4	64008796	missense	probably damaging	0.99
R6360:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R6416:Tnc	UTSW	4	64007816	missense	probably benign	0.05
R6778:Tnc	UTSW	4	63995598	missense	probably benign	0.12
R6798:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6799:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6943:Tnc	UTSW	4	63982745	missense	probably damaging	0.97
R7027:Tnc	UTSW	4	63984589	missense	probably benign	0.02
R7183:Tnc	UTSW	4	64013128	missense	probably damaging	1.00
R7204:Tnc	UTSW	4	63971155	splice site	probably null
R7317:Tnc	UTSW	4	63972722	missense	probably damaging	0.99
R7323:Tnc	UTSW	4	63971232	missense	probably damaging	0.96
R7327:Tnc	UTSW	4	63964762	splice site	probably null
R7382:Tnc	UTSW	4	64014043	nonsense	probably null
R7399:Tnc	UTSW	4	64020657	start gained	probably benign
R7479:Tnc	UTSW	4	64017628	missense	possibly damaging	0.95
R7585:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R8004:Tnc	UTSW	4	63984657	missense	probably benign	0.04
S24628:Tnc	UTSW	4	64018012	missense	probably damaging	1.00
Z1177:Tnc	UTSW	4	63960544	critical splice acceptor site	probably null
Z1177:Tnc	UTSW	4	64007426	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCACTGTGAATTGTATATGCTC -3'
(R):5'- CTGCACTCATCAAACCTGGC -3'

Sequencing Primer
(F):5'- CATCACATGATGCAGTGACAGTG -3'
(R):5'- TGCACTCATCAAACCTGGCATAATG -3'

Posted On

2016-11-09