Incidental Mutation 'R5686:Akap9'
ID 443347
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase anchor protein 9
Synonyms mei2-5, repro12, AKAP450, G1-448-15, 5730481H23Rik
MMRRC Submission 043319-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.436) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 3977410-4130204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4021926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1158 (C1158S)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: C1158S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: C1158S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123119
Predicted Effect probably benign
Transcript: ENSMUST00000133952
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,451,433 (GRCm39) E839G possibly damaging Het
Adgrf3 T A 5: 30,402,304 (GRCm39) T575S probably damaging Het
Arhgap39 A G 15: 76,610,833 (GRCm39) F926L probably damaging Het
BC035947 G T 1: 78,474,567 (GRCm39) T655K probably benign Het
Bcas1 T C 2: 170,248,730 (GRCm39) T64A probably benign Het
Bltp1 T A 3: 36,971,809 (GRCm39) F514Y probably benign Het
Brca2 A G 5: 150,464,369 (GRCm39) K1378E probably benign Het
Card6 A T 15: 5,130,435 (GRCm39) N320K probably damaging Het
Ccdc3 A T 2: 5,142,871 (GRCm39) I43F probably damaging Het
Cd200r1 T C 16: 44,610,527 (GRCm39) S212P probably damaging Het
Cdh8 T C 8: 99,759,854 (GRCm39) I632V probably benign Het
Col25a1 A G 3: 130,357,803 (GRCm39) E477G probably damaging Het
Cpne5 A T 17: 29,402,991 (GRCm39) C215S possibly damaging Het
Crim1 T A 17: 78,681,512 (GRCm39) S989T possibly damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dync1h1 T A 12: 110,582,838 (GRCm39) N340K probably benign Het
Eif4e2 G A 1: 87,153,960 (GRCm39) probably null Het
Ephb6 G T 6: 41,596,638 (GRCm39) R895L possibly damaging Het
Esrrg T A 1: 187,882,395 (GRCm39) H217Q probably benign Het
Fgl1 T A 8: 41,653,594 (GRCm39) K100* probably null Het
Flt4 T C 11: 49,521,430 (GRCm39) V450A probably benign Het
G6pc2 A T 2: 69,051,128 (GRCm39) I74L probably benign Het
Gabrr1 T C 4: 33,161,684 (GRCm39) M336T probably damaging Het
Gli1 T A 10: 127,173,305 (GRCm39) T118S probably benign Het
Gm5435 A T 12: 82,542,800 (GRCm39) noncoding transcript Het
Got1l1 A G 8: 27,688,087 (GRCm39) L314P probably damaging Het
Hk3 T A 13: 55,154,626 (GRCm39) I740F probably damaging Het
Htr7 C A 19: 35,947,271 (GRCm39) A248S probably damaging Het
Igsf9b A G 9: 27,235,475 (GRCm39) T508A probably damaging Het
Il16 T A 7: 83,297,936 (GRCm39) N431I probably benign Het
Lax1 G A 1: 133,607,914 (GRCm39) P276S probably damaging Het
Lrp2 A T 2: 69,341,405 (GRCm39) V925E possibly damaging Het
Lrp3 T A 7: 34,902,910 (GRCm39) T479S possibly damaging Het
Metrn G A 17: 26,014,191 (GRCm39) R212C probably damaging Het
Mlip A C 9: 77,254,975 (GRCm39) probably null Het
Mmp24 C T 2: 155,641,697 (GRCm39) T175I probably damaging Het
N6amt1 A T 16: 87,151,223 (GRCm39) D28V probably damaging Het
Or1e21 A T 11: 73,344,677 (GRCm39) Y120* probably null Het
Or4f4b G A 2: 111,314,488 (GRCm39) G238R probably damaging Het
Or5p52 A G 7: 107,502,119 (GRCm39) H65R probably damaging Het
Or5p66 G T 7: 107,885,949 (GRCm39) A128E probably damaging Het
Or6d15 T C 6: 116,559,890 (GRCm39) T6A probably benign Het
Or8b12i T A 9: 20,082,265 (GRCm39) I201F possibly damaging Het
Pcdh17 T A 14: 84,770,433 (GRCm39) N970K probably damaging Het
Pdzrn3 T C 6: 101,128,389 (GRCm39) Y759C probably damaging Het
Pkd2l2 T C 18: 34,558,290 (GRCm39) L323P probably damaging Het
Psg21 G T 7: 18,386,183 (GRCm39) probably benign Het
Rest T C 5: 77,429,573 (GRCm39) V664A probably benign Het
Sco2 G A 15: 89,256,175 (GRCm39) R160* probably null Het
Sfswap T A 5: 129,591,882 (GRCm39) S300T probably damaging Het
Slc5a10 A T 11: 61,569,392 (GRCm39) M329K probably benign Het
Slco1a5 G A 6: 142,182,033 (GRCm39) P564S probably damaging Het
Stk38 A G 17: 29,201,103 (GRCm39) F191S probably damaging Het
Svep1 T A 4: 58,072,826 (GRCm39) Y2161F possibly damaging Het
Tada2a G A 11: 83,970,428 (GRCm39) T441M possibly damaging Het
Tg T A 15: 66,560,738 (GRCm39) N1033K probably benign Het
Thoc3 A T 13: 54,615,686 (GRCm39) I126N probably damaging Het
Tnc T C 4: 63,925,967 (GRCm39) probably null Het
Tnc A T 4: 63,927,032 (GRCm39) D831E possibly damaging Het
Uhmk1 A T 1: 170,038,787 (GRCm39) V100E probably damaging Het
Usp43 G A 11: 67,812,742 (GRCm39) probably benign Het
Vmn2r90 A T 17: 17,933,712 (GRCm39) Y424F probably benign Het
Vps33a C T 5: 123,685,064 (GRCm39) probably null Het
Xirp2 A T 2: 67,312,642 (GRCm39) K37I probably damaging Het
Zfp106 A T 2: 120,363,988 (GRCm39) probably null Het
Zfp748 A T 13: 67,690,647 (GRCm39) C204* probably null Het
Zfp998 T C 13: 66,579,722 (GRCm39) R254G probably benign Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4,096,639 (GRCm39) missense probably damaging 0.97
IGL00642:Akap9 APN 5 4,010,842 (GRCm39) missense probably damaging 0.99
IGL00786:Akap9 APN 5 4,120,522 (GRCm39) missense probably damaging 1.00
IGL00788:Akap9 APN 5 4,110,480 (GRCm39) missense probably damaging 1.00
IGL00969:Akap9 APN 5 4,051,550 (GRCm39) missense probably benign
IGL01014:Akap9 APN 5 4,018,683 (GRCm39) missense probably benign 0.41
IGL01302:Akap9 APN 5 4,020,711 (GRCm39) missense probably benign 0.27
IGL01610:Akap9 APN 5 4,082,839 (GRCm39) missense possibly damaging 0.95
IGL01620:Akap9 APN 5 4,010,218 (GRCm39) missense probably benign 0.11
IGL01862:Akap9 APN 5 4,115,856 (GRCm39) missense probably damaging 0.99
IGL01862:Akap9 APN 5 4,001,705 (GRCm39) missense probably damaging 0.99
IGL02151:Akap9 APN 5 4,082,728 (GRCm39) nonsense probably null
IGL02635:Akap9 APN 5 4,120,500 (GRCm39) missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4,119,130 (GRCm39) missense possibly damaging 0.88
IGL02967:Akap9 APN 5 4,026,164 (GRCm39) missense probably benign 0.07
IGL03064:Akap9 APN 5 4,018,755 (GRCm39) missense probably damaging 1.00
IGL03289:Akap9 APN 5 4,127,261 (GRCm39) missense probably damaging 1.00
Andy UTSW 5 4,011,764 (GRCm39) nonsense probably null
blimey UTSW 5 4,120,397 (GRCm39) nonsense probably null
hoarder UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
marinarum UTSW 5 4,063,875 (GRCm39) nonsense probably null
miser UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
naviculus UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
thrifty UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
wee_one UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
FR4449:Akap9 UTSW 5 4,031,214 (GRCm39) unclassified probably benign
PIT1430001:Akap9 UTSW 5 4,079,849 (GRCm39) missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4,096,221 (GRCm39) missense probably benign 0.24
R0088:Akap9 UTSW 5 4,011,946 (GRCm39) missense probably benign 0.22
R0309:Akap9 UTSW 5 4,119,038 (GRCm39) missense probably benign 0.01
R0387:Akap9 UTSW 5 4,001,678 (GRCm39) splice site probably benign
R0440:Akap9 UTSW 5 4,114,569 (GRCm39) missense probably damaging 0.99
R0441:Akap9 UTSW 5 4,011,714 (GRCm39) missense probably benign 0.15
R0491:Akap9 UTSW 5 4,022,851 (GRCm39) unclassified probably benign
R0501:Akap9 UTSW 5 4,020,685 (GRCm39) missense probably damaging 1.00
R0507:Akap9 UTSW 5 4,119,043 (GRCm39) missense probably benign 0.41
R0544:Akap9 UTSW 5 4,119,185 (GRCm39) missense probably benign 0.22
R0581:Akap9 UTSW 5 4,100,620 (GRCm39) missense probably benign 0.03
R0611:Akap9 UTSW 5 4,004,870 (GRCm39) missense probably benign 0.00
R0620:Akap9 UTSW 5 4,114,136 (GRCm39) missense probably damaging 0.98
R0639:Akap9 UTSW 5 4,110,318 (GRCm39) missense probably damaging 1.00
R0932:Akap9 UTSW 5 4,096,492 (GRCm39) missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4,114,742 (GRCm39) splice site probably null
R1101:Akap9 UTSW 5 4,096,205 (GRCm39) missense probably benign 0.00
R1159:Akap9 UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
R1170:Akap9 UTSW 5 4,105,671 (GRCm39) missense probably benign
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1453:Akap9 UTSW 5 4,025,614 (GRCm39) splice site probably null
R1551:Akap9 UTSW 5 4,119,174 (GRCm39) missense probably benign 0.02
R1608:Akap9 UTSW 5 4,011,783 (GRCm39) missense probably damaging 1.00
R1652:Akap9 UTSW 5 4,127,210 (GRCm39) missense probably damaging 1.00
R1659:Akap9 UTSW 5 4,114,633 (GRCm39) missense probably damaging 1.00
R1713:Akap9 UTSW 5 4,089,345 (GRCm39) critical splice donor site probably null
R1719:Akap9 UTSW 5 4,007,645 (GRCm39) nonsense probably null
R1720:Akap9 UTSW 5 4,022,791 (GRCm39) missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4,051,667 (GRCm39) missense probably benign 0.41
R1872:Akap9 UTSW 5 4,051,406 (GRCm39) missense probably damaging 1.00
R1876:Akap9 UTSW 5 4,011,809 (GRCm39) missense probably benign 0.28
R1881:Akap9 UTSW 5 4,100,173 (GRCm39) missense probably benign
R1950:Akap9 UTSW 5 4,010,677 (GRCm39) missense probably damaging 1.00
R1980:Akap9 UTSW 5 4,022,771 (GRCm39) missense probably damaging 0.99
R1993:Akap9 UTSW 5 4,088,520 (GRCm39) splice site probably null
R2008:Akap9 UTSW 5 4,010,131 (GRCm39) missense possibly damaging 0.47
R2020:Akap9 UTSW 5 4,011,967 (GRCm39) missense probably damaging 1.00
R2051:Akap9 UTSW 5 4,025,685 (GRCm39) nonsense probably null
R2061:Akap9 UTSW 5 4,011,010 (GRCm39) missense probably damaging 1.00
R2109:Akap9 UTSW 5 4,094,847 (GRCm39) missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4,114,509 (GRCm39) missense probably damaging 1.00
R2225:Akap9 UTSW 5 4,127,271 (GRCm39) missense probably damaging 0.96
R2232:Akap9 UTSW 5 4,096,603 (GRCm39) missense probably damaging 1.00
R2424:Akap9 UTSW 5 4,115,279 (GRCm39) missense probably damaging 0.97
R2483:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R2879:Akap9 UTSW 5 4,026,353 (GRCm39) intron probably benign
R3622:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3623:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3624:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4,120,351 (GRCm39) missense probably damaging 1.00
R3806:Akap9 UTSW 5 4,004,410 (GRCm39) missense probably benign 0.00
R3919:Akap9 UTSW 5 4,011,764 (GRCm39) nonsense probably null
R4023:Akap9 UTSW 5 4,042,077 (GRCm39) missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4,093,996 (GRCm39) missense probably damaging 0.99
R4434:Akap9 UTSW 5 4,082,708 (GRCm39) missense probably damaging 0.99
R4529:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4530:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4532:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4533:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4585:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4586:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4655:Akap9 UTSW 5 4,096,403 (GRCm39) missense probably benign 0.14
R4676:Akap9 UTSW 5 4,114,515 (GRCm39) nonsense probably null
R4676:Akap9 UTSW 5 4,082,774 (GRCm39) missense probably damaging 1.00
R4724:Akap9 UTSW 5 4,105,339 (GRCm39) missense probably benign
R4731:Akap9 UTSW 5 4,012,266 (GRCm39) missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4733:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4743:Akap9 UTSW 5 4,011,013 (GRCm39) missense probably damaging 1.00
R4749:Akap9 UTSW 5 4,018,737 (GRCm39) missense probably benign 0.41
R4756:Akap9 UTSW 5 4,051,418 (GRCm39) missense probably damaging 0.99
R4757:Akap9 UTSW 5 4,058,382 (GRCm39) missense probably damaging 1.00
R4860:Akap9 UTSW 5 4,084,916 (GRCm39) intron probably benign
R4937:Akap9 UTSW 5 4,100,145 (GRCm39) splice site probably null
R4960:Akap9 UTSW 5 4,007,664 (GRCm39) missense probably benign 0.15
R4974:Akap9 UTSW 5 4,011,466 (GRCm39) missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4,051,748 (GRCm39) missense probably damaging 0.96
R5160:Akap9 UTSW 5 4,080,007 (GRCm39) missense probably damaging 1.00
R5200:Akap9 UTSW 5 4,010,734 (GRCm39) missense probably benign 0.00
R5245:Akap9 UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
R5293:Akap9 UTSW 5 3,998,687 (GRCm39) missense probably damaging 0.99
R5408:Akap9 UTSW 5 4,108,458 (GRCm39) missense possibly damaging 0.84
R5507:Akap9 UTSW 5 4,018,683 (GRCm39) missense probably benign 0.41
R5517:Akap9 UTSW 5 4,051,665 (GRCm39) missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4,114,714 (GRCm39) missense possibly damaging 0.93
R5619:Akap9 UTSW 5 4,004,760 (GRCm39) intron probably benign
R5645:Akap9 UTSW 5 4,100,590 (GRCm39) missense probably benign 0.09
R5669:Akap9 UTSW 5 4,100,540 (GRCm39) nonsense probably null
R5697:Akap9 UTSW 5 4,010,170 (GRCm39) missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
R5875:Akap9 UTSW 5 4,127,285 (GRCm39) missense probably benign 0.01
R5897:Akap9 UTSW 5 4,127,904 (GRCm39) missense probably benign 0.23
R5999:Akap9 UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
R6025:Akap9 UTSW 5 4,082,801 (GRCm39) missense probably damaging 1.00
R6078:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6138:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6225:Akap9 UTSW 5 4,012,105 (GRCm39) missense probably damaging 1.00
R6243:Akap9 UTSW 5 4,115,000 (GRCm39) splice site probably null
R6326:Akap9 UTSW 5 4,012,061 (GRCm39) missense probably damaging 1.00
R6564:Akap9 UTSW 5 4,078,491 (GRCm39) missense probably damaging 0.98
R6617:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6625:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6632:Akap9 UTSW 5 4,063,842 (GRCm39) splice site probably null
R6677:Akap9 UTSW 5 4,079,869 (GRCm39) missense probably benign 0.21
R6717:Akap9 UTSW 5 4,114,086 (GRCm39) missense probably damaging 1.00
R6893:Akap9 UTSW 5 4,011,709 (GRCm39) missense probably benign 0.32
R6915:Akap9 UTSW 5 4,010,551 (GRCm39) missense probably benign 0.03
R6938:Akap9 UTSW 5 4,096,628 (GRCm39) missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4,115,866 (GRCm39) missense possibly damaging 0.65
R7032:Akap9 UTSW 5 4,004,896 (GRCm39) missense probably benign
R7164:Akap9 UTSW 5 4,110,364 (GRCm39) missense probably damaging 0.96
R7170:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7192:Akap9 UTSW 5 4,055,723 (GRCm39) splice site probably null
R7284:Akap9 UTSW 5 4,006,246 (GRCm39) missense probably damaging 1.00
R7299:Akap9 UTSW 5 4,082,696 (GRCm39) missense probably damaging 1.00
R7313:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7326:Akap9 UTSW 5 4,095,930 (GRCm39) missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4,096,364 (GRCm39) missense probably damaging 0.99
R7455:Akap9 UTSW 5 4,022,792 (GRCm39) missense probably benign 0.03
R7482:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7489:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7525:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7528:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7576:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7577:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7578:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7610:Akap9 UTSW 5 4,007,677 (GRCm39) missense possibly damaging 0.95
R7658:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7754:Akap9 UTSW 5 4,096,736 (GRCm39) missense probably benign 0.03
R7818:Akap9 UTSW 5 4,063,875 (GRCm39) nonsense probably null
R7979:Akap9 UTSW 5 4,100,381 (GRCm39) missense probably benign
R7991:Akap9 UTSW 5 4,114,949 (GRCm39) splice site probably null
R8036:Akap9 UTSW 5 4,120,397 (GRCm39) nonsense probably null
R8054:Akap9 UTSW 5 4,088,707 (GRCm39) critical splice donor site probably null
R8116:Akap9 UTSW 5 4,111,183 (GRCm39) missense probably benign 0.04
R8150:Akap9 UTSW 5 4,011,982 (GRCm39) missense probably damaging 1.00
R8234:Akap9 UTSW 5 4,094,845 (GRCm39) missense probably benign 0.18
R8348:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8365:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8366:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8448:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8466:Akap9 UTSW 5 4,088,659 (GRCm39) missense probably damaging 1.00
R8772:Akap9 UTSW 5 4,096,255 (GRCm39) missense probably damaging 1.00
R8881:Akap9 UTSW 5 4,011,279 (GRCm39) missense
R8937:Akap9 UTSW 5 4,094,048 (GRCm39) missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3,998,805 (GRCm39) missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4,105,650 (GRCm39) missense probably benign
R9049:Akap9 UTSW 5 4,114,597 (GRCm39) missense
R9074:Akap9 UTSW 5 4,127,959 (GRCm39) missense probably benign 0.40
R9124:Akap9 UTSW 5 4,111,284 (GRCm39) missense probably damaging 0.99
R9129:Akap9 UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
R9371:Akap9 UTSW 5 4,011,852 (GRCm39) missense possibly damaging 0.83
R9424:Akap9 UTSW 5 4,012,224 (GRCm39) nonsense probably null
R9424:Akap9 UTSW 5 4,012,223 (GRCm39) nonsense probably null
R9509:Akap9 UTSW 5 4,096,349 (GRCm39) missense probably benign
R9515:Akap9 UTSW 5 4,105,709 (GRCm39) missense probably damaging 1.00
R9567:Akap9 UTSW 5 4,127,311 (GRCm39) missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4,119,149 (GRCm39) missense probably damaging 1.00
R9619:Akap9 UTSW 5 4,094,833 (GRCm39) missense probably damaging 1.00
R9635:Akap9 UTSW 5 4,100,545 (GRCm39) missense probably benign 0.20
R9680:Akap9 UTSW 5 4,011,587 (GRCm39) missense probably benign 0.03
R9691:Akap9 UTSW 5 4,010,491 (GRCm39) missense probably damaging 1.00
R9726:Akap9 UTSW 5 4,053,757 (GRCm39) missense probably benign 0.39
U15987:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
X0026:Akap9 UTSW 5 4,064,039 (GRCm39) missense probably damaging 1.00
X0057:Akap9 UTSW 5 4,025,598 (GRCm39) critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 4,012,251 (GRCm39) missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4,096,189 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTGATTGCTTACACTTCATG -3'
(R):5'- CGTTTATAAGCAATTGACTTGAGC -3'

Sequencing Primer
(F):5'- GGGAGAGGGAATCCATATTC -3'
(R):5'- TGAGCAAAGTAAATCCTGTTTAACAG -3'
Posted On 2016-11-09