Incidental Mutation 'R5686:Rest'
ID 443349
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene Name RE1-silencing transcription factor
Synonyms NRSF, 2610008J04Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77265491-77286432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77281726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 664 (V664A)
Ref Sequence ENSEMBL: ENSMUSP00000109076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
AlphaFold Q8VIG1
Predicted Effect probably benign
Transcript: ENSMUST00000080359
AA Change: V664A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: V664A

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113449
AA Change: V664A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: V664A

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77275288 missense probably damaging 1.00
pace UTSW 5 77275243 missense possibly damaging 0.94
ruhe UTSW 5 77268362 missense possibly damaging 0.71
R0027:Rest UTSW 5 77282551 missense probably benign
R0479:Rest UTSW 5 77282751 missense probably damaging 0.99
R0526:Rest UTSW 5 77281027 missense probably damaging 0.98
R1865:Rest UTSW 5 77280898 missense probably damaging 1.00
R1869:Rest UTSW 5 77268362 missense possibly damaging 0.71
R1870:Rest UTSW 5 77268362 missense possibly damaging 0.71
R2089:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2347:Rest UTSW 5 77268593 missense probably damaging 1.00
R2366:Rest UTSW 5 77268187 missense probably benign 0.00
R3609:Rest UTSW 5 77282800 missense probably benign 0.06
R4249:Rest UTSW 5 77282112 missense probably benign
R4471:Rest UTSW 5 77281180 missense probably benign 0.01
R4472:Rest UTSW 5 77281180 missense probably benign 0.01
R4685:Rest UTSW 5 77275243 missense possibly damaging 0.94
R5175:Rest UTSW 5 77268372 missense probably damaging 1.00
R5566:Rest UTSW 5 77282326 missense probably benign 0.00
R5976:Rest UTSW 5 77268272 missense probably benign 0.07
R6052:Rest UTSW 5 77281180 missense probably benign 0.34
R6076:Rest UTSW 5 77282974 missense unknown
R6249:Rest UTSW 5 77281224 missense probably benign 0.01
R6448:Rest UTSW 5 77281471 missense possibly damaging 0.75
R6681:Rest UTSW 5 77280997 missense probably damaging 1.00
R6974:Rest UTSW 5 77268199 missense probably damaging 1.00
R7185:Rest UTSW 5 77282484 missense probably benign
R7216:Rest UTSW 5 77282608 missense probably benign 0.04
R7355:Rest UTSW 5 77268028 missense probably benign 0.23
R7360:Rest UTSW 5 77281129 missense probably benign 0.36
R7705:Rest UTSW 5 77268272 missense probably damaging 1.00
R8052:Rest UTSW 5 77268324 missense probably benign 0.04
R8220:Rest UTSW 5 77282478 missense probably benign
R8441:Rest UTSW 5 77281919 missense possibly damaging 0.95
R8699:Rest UTSW 5 77281542 missense probably benign 0.04
R8879:Rest UTSW 5 77282511 missense probably benign 0.00
R8940:Rest UTSW 5 77282868 missense possibly damaging 0.91
R8961:Rest UTSW 5 77268635 missense probably damaging 1.00
R9165:Rest UTSW 5 77281804 small deletion probably benign
R9167:Rest UTSW 5 77281804 small deletion probably benign
R9168:Rest UTSW 5 77281804 small deletion probably benign
R9170:Rest UTSW 5 77281804 small deletion probably benign
R9377:Rest UTSW 5 77268281 missense possibly damaging 0.47
R9476:Rest UTSW 5 77268251 missense probably damaging 0.99
R9566:Rest UTSW 5 77268430 nonsense probably null
R9596:Rest UTSW 5 77275294 missense probably damaging 1.00
Z1177:Rest UTSW 5 77280909 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCAAAGCGCTTCCCTTAAG -3'
(R):5'- GAAGGTTCCATCTCGGCAAG -3'

Sequencing Primer
(F):5'- ATGGGGCAGACAGAACCTTCTTC -3'
(R):5'- CCCCTTTGGGGAGGCTGGGGGTAAGT -3'
Posted On 2016-11-09