Incidental Mutation 'R5686:Vps33a'
ID 443350
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene Name VPS33A CORVET/HOPS core subunit
Synonyms 3830421M04Rik, bf
MMRRC Submission 043319-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123666820-123711104 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 123685064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
AlphaFold Q9D2N9
Predicted Effect probably null
Transcript: ENSMUST00000031388
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,451,433 (GRCm39) E839G possibly damaging Het
Adgrf3 T A 5: 30,402,304 (GRCm39) T575S probably damaging Het
Akap9 T A 5: 4,021,926 (GRCm39) C1158S probably benign Het
Arhgap39 A G 15: 76,610,833 (GRCm39) F926L probably damaging Het
BC035947 G T 1: 78,474,567 (GRCm39) T655K probably benign Het
Bcas1 T C 2: 170,248,730 (GRCm39) T64A probably benign Het
Bltp1 T A 3: 36,971,809 (GRCm39) F514Y probably benign Het
Brca2 A G 5: 150,464,369 (GRCm39) K1378E probably benign Het
Card6 A T 15: 5,130,435 (GRCm39) N320K probably damaging Het
Ccdc3 A T 2: 5,142,871 (GRCm39) I43F probably damaging Het
Cd200r1 T C 16: 44,610,527 (GRCm39) S212P probably damaging Het
Cdh8 T C 8: 99,759,854 (GRCm39) I632V probably benign Het
Col25a1 A G 3: 130,357,803 (GRCm39) E477G probably damaging Het
Cpne5 A T 17: 29,402,991 (GRCm39) C215S possibly damaging Het
Crim1 T A 17: 78,681,512 (GRCm39) S989T possibly damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dync1h1 T A 12: 110,582,838 (GRCm39) N340K probably benign Het
Eif4e2 G A 1: 87,153,960 (GRCm39) probably null Het
Ephb6 G T 6: 41,596,638 (GRCm39) R895L possibly damaging Het
Esrrg T A 1: 187,882,395 (GRCm39) H217Q probably benign Het
Fgl1 T A 8: 41,653,594 (GRCm39) K100* probably null Het
Flt4 T C 11: 49,521,430 (GRCm39) V450A probably benign Het
G6pc2 A T 2: 69,051,128 (GRCm39) I74L probably benign Het
Gabrr1 T C 4: 33,161,684 (GRCm39) M336T probably damaging Het
Gli1 T A 10: 127,173,305 (GRCm39) T118S probably benign Het
Gm5435 A T 12: 82,542,800 (GRCm39) noncoding transcript Het
Got1l1 A G 8: 27,688,087 (GRCm39) L314P probably damaging Het
Hk3 T A 13: 55,154,626 (GRCm39) I740F probably damaging Het
Htr7 C A 19: 35,947,271 (GRCm39) A248S probably damaging Het
Igsf9b A G 9: 27,235,475 (GRCm39) T508A probably damaging Het
Il16 T A 7: 83,297,936 (GRCm39) N431I probably benign Het
Lax1 G A 1: 133,607,914 (GRCm39) P276S probably damaging Het
Lrp2 A T 2: 69,341,405 (GRCm39) V925E possibly damaging Het
Lrp3 T A 7: 34,902,910 (GRCm39) T479S possibly damaging Het
Metrn G A 17: 26,014,191 (GRCm39) R212C probably damaging Het
Mlip A C 9: 77,254,975 (GRCm39) probably null Het
Mmp24 C T 2: 155,641,697 (GRCm39) T175I probably damaging Het
N6amt1 A T 16: 87,151,223 (GRCm39) D28V probably damaging Het
Or1e21 A T 11: 73,344,677 (GRCm39) Y120* probably null Het
Or4f4b G A 2: 111,314,488 (GRCm39) G238R probably damaging Het
Or5p52 A G 7: 107,502,119 (GRCm39) H65R probably damaging Het
Or5p66 G T 7: 107,885,949 (GRCm39) A128E probably damaging Het
Or6d15 T C 6: 116,559,890 (GRCm39) T6A probably benign Het
Or8b12i T A 9: 20,082,265 (GRCm39) I201F possibly damaging Het
Pcdh17 T A 14: 84,770,433 (GRCm39) N970K probably damaging Het
Pdzrn3 T C 6: 101,128,389 (GRCm39) Y759C probably damaging Het
Pkd2l2 T C 18: 34,558,290 (GRCm39) L323P probably damaging Het
Psg21 G T 7: 18,386,183 (GRCm39) probably benign Het
Rest T C 5: 77,429,573 (GRCm39) V664A probably benign Het
Sco2 G A 15: 89,256,175 (GRCm39) R160* probably null Het
Sfswap T A 5: 129,591,882 (GRCm39) S300T probably damaging Het
Slc5a10 A T 11: 61,569,392 (GRCm39) M329K probably benign Het
Slco1a5 G A 6: 142,182,033 (GRCm39) P564S probably damaging Het
Stk38 A G 17: 29,201,103 (GRCm39) F191S probably damaging Het
Svep1 T A 4: 58,072,826 (GRCm39) Y2161F possibly damaging Het
Tada2a G A 11: 83,970,428 (GRCm39) T441M possibly damaging Het
Tg T A 15: 66,560,738 (GRCm39) N1033K probably benign Het
Thoc3 A T 13: 54,615,686 (GRCm39) I126N probably damaging Het
Tnc T C 4: 63,925,967 (GRCm39) probably null Het
Tnc A T 4: 63,927,032 (GRCm39) D831E possibly damaging Het
Uhmk1 A T 1: 170,038,787 (GRCm39) V100E probably damaging Het
Usp43 G A 11: 67,812,742 (GRCm39) probably benign Het
Vmn2r90 A T 17: 17,933,712 (GRCm39) Y424F probably benign Het
Xirp2 A T 2: 67,312,642 (GRCm39) K37I probably damaging Het
Zfp106 A T 2: 120,363,988 (GRCm39) probably null Het
Zfp748 A T 13: 67,690,647 (GRCm39) C204* probably null Het
Zfp998 T C 13: 66,579,722 (GRCm39) R254G probably benign Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123,711,006 (GRCm39) missense probably benign 0.00
IGL01459:Vps33a APN 5 123,673,371 (GRCm39) missense probably benign 0.08
IGL02473:Vps33a APN 5 123,707,634 (GRCm39) missense probably damaging 1.00
IGL02899:Vps33a APN 5 123,669,239 (GRCm39) missense probably damaging 1.00
R0498:Vps33a UTSW 5 123,709,024 (GRCm39) missense probably benign 0.40
R1134:Vps33a UTSW 5 123,708,975 (GRCm39) missense probably damaging 0.97
R1928:Vps33a UTSW 5 123,696,684 (GRCm39) missense probably benign 0.02
R2012:Vps33a UTSW 5 123,669,244 (GRCm39) splice site probably null
R2926:Vps33a UTSW 5 123,707,634 (GRCm39) missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123,673,274 (GRCm39) splice site probably null
R3872:Vps33a UTSW 5 123,669,255 (GRCm39) missense probably benign 0.16
R4437:Vps33a UTSW 5 123,669,947 (GRCm39) missense probably benign
R5153:Vps33a UTSW 5 123,696,691 (GRCm39) missense probably damaging 1.00
R5396:Vps33a UTSW 5 123,696,693 (GRCm39) missense probably damaging 0.98
R5714:Vps33a UTSW 5 123,707,563 (GRCm39) missense probably benign
R5814:Vps33a UTSW 5 123,703,119 (GRCm39) missense probably damaging 1.00
R6845:Vps33a UTSW 5 123,673,335 (GRCm39) missense probably benign 0.02
R7183:Vps33a UTSW 5 123,673,278 (GRCm39) missense probably null 0.83
R7359:Vps33a UTSW 5 123,696,696 (GRCm39) missense probably benign 0.00
R7593:Vps33a UTSW 5 123,674,619 (GRCm39) missense probably benign 0.00
R7855:Vps33a UTSW 5 123,709,042 (GRCm39) missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123,673,312 (GRCm39) missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123,696,738 (GRCm39) missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123,672,015 (GRCm39) missense probably benign 0.04
R8275:Vps33a UTSW 5 123,707,522 (GRCm39) missense probably damaging 0.99
R8434:Vps33a UTSW 5 123,671,944 (GRCm39) missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123,709,538 (GRCm39) critical splice donor site probably null
R8879:Vps33a UTSW 5 123,671,962 (GRCm39) missense probably damaging 1.00
R8880:Vps33a UTSW 5 123,707,506 (GRCm39) missense probably damaging 0.98
R9172:Vps33a UTSW 5 123,674,604 (GRCm39) missense probably benign 0.17
R9440:Vps33a UTSW 5 123,703,047 (GRCm39) missense probably damaging 1.00
R9502:Vps33a UTSW 5 123,696,705 (GRCm39) missense probably benign 0.00
R9725:Vps33a UTSW 5 123,669,135 (GRCm39) missense possibly damaging 0.95
X0026:Vps33a UTSW 5 123,685,160 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CACTTACTAGCACTGGGACC -3'
(R):5'- GGTTTAGCTTGATTTACGTCCC -3'

Sequencing Primer
(F):5'- TTACTAGCACTGGGACCCATGC -3'
(R):5'- GTGAAACACCCTGTGAGATGCTC -3'
Posted On 2016-11-09