Mutagenetix > Incidental Mutations

Incidental Mutation 'R5686:Vps33a'

443350

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

043319-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5686 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 123547001 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

Predicted Effect

probably null
Transcript: ENSMUST00000031388

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Meta Mutation Damage Score

0.9594

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,303,314	E839G	possibly damaging	Het
2410141K09Rik	T	C	13: 66,431,663	R254G	probably benign	Het
4932438A13Rik	T	A	3: 36,917,660	F514Y	probably benign	Het
Adgrf3	T	A	5: 30,197,306	T575S	probably damaging	Het
Akap9	T	A	5: 3,971,926	C1158S	probably benign	Het
Arhgap39	A	G	15: 76,726,633	F926L	probably damaging	Het
BC035947	G	T	1: 78,497,930	T655K	probably benign	Het
Bcas1	T	C	2: 170,406,810	T64A	probably benign	Het
Brca2	A	G	5: 150,540,904	K1378E	probably benign	Het
Card6	A	T	15: 5,100,953	N320K	probably damaging	Het
Ccdc3	A	T	2: 5,138,060	I43F	probably damaging	Het
Cd200r1	T	C	16: 44,790,164	S212P	probably damaging	Het
Cdh8	T	C	8: 99,033,222	I632V	probably benign	Het
Col25a1	A	G	3: 130,564,154	E477G	probably damaging	Het
Cpne5	A	T	17: 29,184,017	C215S	possibly damaging	Het
Crim1	T	A	17: 78,374,083	S989T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dync1h1	T	A	12: 110,616,404	N340K	probably benign	Het
Eif4e2	G	A	1: 87,226,238		probably null	Het
Ephb6	G	T	6: 41,619,704	R895L	possibly damaging	Het
Esrrg	T	A	1: 188,150,198	H217Q	probably benign	Het
Fgl1	T	A	8: 41,200,557	K100*	probably null	Het
Flt4	T	C	11: 49,630,603	V450A	probably benign	Het
G6pc2	A	T	2: 69,220,784	I74L	probably benign	Het
Gabrr1	T	C	4: 33,161,684	M336T	probably damaging	Het
Gli1	T	A	10: 127,337,436	T118S	probably benign	Het
Gm5435	A	T	12: 82,496,026		noncoding transcript	Het
Got1l1	A	G	8: 27,198,059	L314P	probably damaging	Het
Hk3	T	A	13: 55,006,813	I740F	probably damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Igsf9b	A	G	9: 27,324,179	T508A	probably damaging	Het
Il16	T	A	7: 83,648,728	N431I	probably benign	Het
Lax1	G	A	1: 133,680,176	P276S	probably damaging	Het
Lrp2	A	T	2: 69,511,061	V925E	possibly damaging	Het
Lrp3	T	A	7: 35,203,485	T479S	possibly damaging	Het
Metrn	G	A	17: 25,795,217	R212C	probably damaging	Het
Mlip	A	C	9: 77,347,693		probably null	Het
Mmp24	C	T	2: 155,799,777	T175I	probably damaging	Het
N6amt1	A	T	16: 87,354,335	D28V	probably damaging	Het
Olfr1289	G	A	2: 111,484,143	G238R	probably damaging	Het
Olfr215	T	C	6: 116,582,929	T6A	probably benign	Het
Olfr380	A	T	11: 73,453,851	Y120*	probably null	Het
Olfr472	A	G	7: 107,902,912	H65R	probably damaging	Het
Olfr490	G	T	7: 108,286,742	A128E	probably damaging	Het
Olfr870	T	A	9: 20,170,969	I201F	possibly damaging	Het
Pcdh17	T	A	14: 84,532,993	N970K	probably damaging	Het
Pdzrn3	T	C	6: 101,151,428	Y759C	probably damaging	Het
Pkd2l2	T	C	18: 34,425,237	L323P	probably damaging	Het
Psg21	G	T	7: 18,652,258		probably benign	Het
Rest	T	C	5: 77,281,726	V664A	probably benign	Het
Sco2	G	A	15: 89,371,972	R160*	probably null	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc5a10	A	T	11: 61,678,566	M329K	probably benign	Het
Slco1a5	G	A	6: 142,236,307	P564S	probably damaging	Het
Stk38	A	G	17: 28,982,129	F191S	probably damaging	Het
Svep1	T	A	4: 58,072,826	Y2161F	possibly damaging	Het
Tada2a	G	A	11: 84,079,602	T441M	possibly damaging	Het
Tg	T	A	15: 66,688,889	N1033K	probably benign	Het
Thoc3	A	T	13: 54,467,873	I126N	probably damaging	Het
Tnc	T	C	4: 64,007,730		probably null	Het
Tnc	A	T	4: 64,008,795	D831E	possibly damaging	Het
Uhmk1	A	T	1: 170,211,218	V100E	probably damaging	Het
Usp43	G	A	11: 67,921,916		probably benign	Het
Vmn2r90	A	T	17: 17,713,450	Y424F	probably benign	Het
Xirp2	A	T	2: 67,482,298	K37I	probably damaging	Het
Zfp106	A	T	2: 120,533,507		probably null	Het
Zfp748	A	T	13: 67,542,528	C204*	probably null	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CACTTACTAGCACTGGGACC -3'
(R):5'- GGTTTAGCTTGATTTACGTCCC -3'

Sequencing Primer
(F):5'- TTACTAGCACTGGGACCCATGC -3'
(R):5'- GTGAAACACCCTGTGAGATGCTC -3'

Posted On

2016-11-09