Incidental Mutation 'R5686:Sfswap'
ID443351
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5686 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129514818 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 300 (S300T)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect probably damaging
Transcript: ENSMUST00000053737
AA Change: S300T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: S300T

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200662
Meta Mutation Damage Score 0.1327 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGACCCAAATATTTACATGTATGTG -3'
(R):5'- GAGAAATGCAGACACCTCGG -3'

Sequencing Primer
(F):5'- AAGCCAAGGTTTTGAGTCCC -3'
(R):5'- CTGTACCATAGGATATGGCAG -3'
Posted On2016-11-09