Incidental Mutation 'R5686:Slco1a5'
ID 443358
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Name solute carrier organic anion transporter family, member 1a5
Synonyms Oatp3, Slc21a7
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 142234227-142322981 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 142236307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 564 (P564S)
Ref Sequence ENSEMBL: ENSMUSP00000137607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000153268]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000081380
AA Change: P564S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: P564S

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111825
AA Change: P564S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: P564S

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153268
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157614
Meta Mutation Damage Score 0.6763 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R2760:Slco1a5 UTSW 6 142250271 missense probably benign 0.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3421:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R3977:Slco1a5 UTSW 6 142258972 splice site probably benign
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5792:Slco1a5 UTSW 6 142242113 missense probably damaging 1.00
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 splice site probably null
R7579:Slco1a5 UTSW 6 142275481 missense probably benign 0.00
R8117:Slco1a5 UTSW 6 142262692 missense probably damaging 1.00
R8209:Slco1a5 UTSW 6 142262682 missense probably damaging 1.00
R8217:Slco1a5 UTSW 6 142275476 missense probably benign 0.13
R8358:Slco1a5 UTSW 6 142262685 missense probably benign 0.45
R8710:Slco1a5 UTSW 6 142253102 missense probably benign 0.03
R9071:Slco1a5 UTSW 6 142250326 missense possibly damaging 0.50
R9316:Slco1a5 UTSW 6 142250209 missense probably damaging 0.99
R9427:Slco1a5 UTSW 6 142268275 missense probably damaging 0.98
R9619:Slco1a5 UTSW 6 142253120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCCAAATGAAATCGTATTACTCGAG -3'
(R):5'- GCACTGGCTACTTGAGAATGAAG -3'

Sequencing Primer
(F):5'- ATGAAATCGTATTACTCGAGAGAATG -3'
(R):5'- TGCTGGATGTACAGAAAATTAATGG -3'
Posted On 2016-11-09