Incidental Mutation 'R5686:Tada2a'
ID 443376
Institutional Source Beutler Lab
Gene Symbol Tada2a
Ensembl Gene ENSMUSG00000018651
Gene Name transcriptional adaptor 2A
Synonyms Tada2l, D030022J10Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84078920-84129600 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84079602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 441 (T441M)
Ref Sequence ENSEMBL: ENSMUSP00000018795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018795] [ENSMUST00000141852]
AlphaFold Q8CHV6
PDB Structure Structural and functional analysis of ada2 alpha swirm domain [SOLUTION NMR]
Structural and functional analysis of ADA2 alpha swirm domain [SOLUTION NMR]
Solution structure of SWIRM domain of mouse transcriptional adaptor 2-like [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018795
AA Change: T441M

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018795
Gene: ENSMUSG00000018651
AA Change: T441M

DomainStartEndE-ValueType
Blast:ZnF_ZZ 11 57 2e-25 BLAST
SANT 71 120 3.1e-10 SMART
low complexity region 134 143 N/A INTRINSIC
Pfam:SWIRM 364 441 5.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125566
Predicted Effect probably benign
Transcript: ENSMUST00000141852
SMART Domains Protein: ENSMUSP00000119022
Gene: ENSMUSG00000018651

DomainStartEndE-ValueType
Pfam:SWIRM 168 235 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156151
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Tada2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Tada2a APN 11 84087192 splice site probably benign
PIT4131001:Tada2a UTSW 11 84079737 missense probably damaging 0.98
R1438:Tada2a UTSW 11 84110011 missense probably damaging 0.99
R1615:Tada2a UTSW 11 84103100 missense probably damaging 1.00
R1688:Tada2a UTSW 11 84084759 critical splice acceptor site probably null
R1693:Tada2a UTSW 11 84082069 missense probably damaging 1.00
R2146:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2147:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2150:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R3980:Tada2a UTSW 11 84103120 missense probably benign 0.41
R5364:Tada2a UTSW 11 84121147 missense probably benign
R7117:Tada2a UTSW 11 84085688 missense probably damaging 0.99
R7439:Tada2a UTSW 11 84126986 critical splice donor site probably null
Z1177:Tada2a UTSW 11 84093667 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCTGACGCACTATCCTGACAAC -3'
(R):5'- ACCTGCTGGATGAATTTGTGAG -3'

Sequencing Primer
(F):5'- TATCCTGACAACAGCAAGCAG -3'
(R):5'- TGTGAGAATGACAGTGCTAATTACG -3'
Posted On 2016-11-09