Incidental Mutation 'R5686:Arhgap39'
ID 443387
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene Name Rho GTPase activating protein 39
Synonyms D15Wsu169e
MMRRC Submission 043319-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76608183-76702366 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76610833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 926 (F926L)
Ref Sequence ENSEMBL: ENSMUSP00000076993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000036247] [ENSMUST00000049956] [ENSMUST00000077821] [ENSMUST00000228990]
AlphaFold P59281
Predicted Effect probably damaging
Transcript: ENSMUST00000036176
AA Change: F957L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: F957L

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036247
SMART Domains Protein: ENSMUSP00000039910
Gene: ENSMUSG00000116138

DomainStartEndE-ValueType
Pfam:DUF4505 31 209 5.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049956
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077821
AA Change: F926L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: F926L

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176724
Predicted Effect probably benign
Transcript: ENSMUST00000228990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231059
Meta Mutation Damage Score 0.7548 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,451,433 (GRCm39) E839G possibly damaging Het
Adgrf3 T A 5: 30,402,304 (GRCm39) T575S probably damaging Het
Akap9 T A 5: 4,021,926 (GRCm39) C1158S probably benign Het
BC035947 G T 1: 78,474,567 (GRCm39) T655K probably benign Het
Bcas1 T C 2: 170,248,730 (GRCm39) T64A probably benign Het
Bltp1 T A 3: 36,971,809 (GRCm39) F514Y probably benign Het
Brca2 A G 5: 150,464,369 (GRCm39) K1378E probably benign Het
Card6 A T 15: 5,130,435 (GRCm39) N320K probably damaging Het
Ccdc3 A T 2: 5,142,871 (GRCm39) I43F probably damaging Het
Cd200r1 T C 16: 44,610,527 (GRCm39) S212P probably damaging Het
Cdh8 T C 8: 99,759,854 (GRCm39) I632V probably benign Het
Col25a1 A G 3: 130,357,803 (GRCm39) E477G probably damaging Het
Cpne5 A T 17: 29,402,991 (GRCm39) C215S possibly damaging Het
Crim1 T A 17: 78,681,512 (GRCm39) S989T possibly damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Dync1h1 T A 12: 110,582,838 (GRCm39) N340K probably benign Het
Eif4e2 G A 1: 87,153,960 (GRCm39) probably null Het
Ephb6 G T 6: 41,596,638 (GRCm39) R895L possibly damaging Het
Esrrg T A 1: 187,882,395 (GRCm39) H217Q probably benign Het
Fgl1 T A 8: 41,653,594 (GRCm39) K100* probably null Het
Flt4 T C 11: 49,521,430 (GRCm39) V450A probably benign Het
G6pc2 A T 2: 69,051,128 (GRCm39) I74L probably benign Het
Gabrr1 T C 4: 33,161,684 (GRCm39) M336T probably damaging Het
Gli1 T A 10: 127,173,305 (GRCm39) T118S probably benign Het
Gm5435 A T 12: 82,542,800 (GRCm39) noncoding transcript Het
Got1l1 A G 8: 27,688,087 (GRCm39) L314P probably damaging Het
Hk3 T A 13: 55,154,626 (GRCm39) I740F probably damaging Het
Htr7 C A 19: 35,947,271 (GRCm39) A248S probably damaging Het
Igsf9b A G 9: 27,235,475 (GRCm39) T508A probably damaging Het
Il16 T A 7: 83,297,936 (GRCm39) N431I probably benign Het
Lax1 G A 1: 133,607,914 (GRCm39) P276S probably damaging Het
Lrp2 A T 2: 69,341,405 (GRCm39) V925E possibly damaging Het
Lrp3 T A 7: 34,902,910 (GRCm39) T479S possibly damaging Het
Metrn G A 17: 26,014,191 (GRCm39) R212C probably damaging Het
Mlip A C 9: 77,254,975 (GRCm39) probably null Het
Mmp24 C T 2: 155,641,697 (GRCm39) T175I probably damaging Het
N6amt1 A T 16: 87,151,223 (GRCm39) D28V probably damaging Het
Or1e21 A T 11: 73,344,677 (GRCm39) Y120* probably null Het
Or4f4b G A 2: 111,314,488 (GRCm39) G238R probably damaging Het
Or5p52 A G 7: 107,502,119 (GRCm39) H65R probably damaging Het
Or5p66 G T 7: 107,885,949 (GRCm39) A128E probably damaging Het
Or6d15 T C 6: 116,559,890 (GRCm39) T6A probably benign Het
Or8b12i T A 9: 20,082,265 (GRCm39) I201F possibly damaging Het
Pcdh17 T A 14: 84,770,433 (GRCm39) N970K probably damaging Het
Pdzrn3 T C 6: 101,128,389 (GRCm39) Y759C probably damaging Het
Pkd2l2 T C 18: 34,558,290 (GRCm39) L323P probably damaging Het
Psg21 G T 7: 18,386,183 (GRCm39) probably benign Het
Rest T C 5: 77,429,573 (GRCm39) V664A probably benign Het
Sco2 G A 15: 89,256,175 (GRCm39) R160* probably null Het
Sfswap T A 5: 129,591,882 (GRCm39) S300T probably damaging Het
Slc5a10 A T 11: 61,569,392 (GRCm39) M329K probably benign Het
Slco1a5 G A 6: 142,182,033 (GRCm39) P564S probably damaging Het
Stk38 A G 17: 29,201,103 (GRCm39) F191S probably damaging Het
Svep1 T A 4: 58,072,826 (GRCm39) Y2161F possibly damaging Het
Tada2a G A 11: 83,970,428 (GRCm39) T441M possibly damaging Het
Tg T A 15: 66,560,738 (GRCm39) N1033K probably benign Het
Thoc3 A T 13: 54,615,686 (GRCm39) I126N probably damaging Het
Tnc T C 4: 63,925,967 (GRCm39) probably null Het
Tnc A T 4: 63,927,032 (GRCm39) D831E possibly damaging Het
Uhmk1 A T 1: 170,038,787 (GRCm39) V100E probably damaging Het
Usp43 G A 11: 67,812,742 (GRCm39) probably benign Het
Vmn2r90 A T 17: 17,933,712 (GRCm39) Y424F probably benign Het
Vps33a C T 5: 123,685,064 (GRCm39) probably null Het
Xirp2 A T 2: 67,312,642 (GRCm39) K37I probably damaging Het
Zfp106 A T 2: 120,363,988 (GRCm39) probably null Het
Zfp748 A T 13: 67,690,647 (GRCm39) C204* probably null Het
Zfp998 T C 13: 66,579,722 (GRCm39) R254G probably benign Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76,622,015 (GRCm39) splice site probably benign
IGL01586:Arhgap39 APN 15 76,614,638 (GRCm39) missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76,610,167 (GRCm39) missense probably null 1.00
IGL02017:Arhgap39 APN 15 76,621,237 (GRCm39) missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76,609,184 (GRCm39) makesense probably null
IGL03333:Arhgap39 APN 15 76,610,932 (GRCm39) missense probably benign 0.05
R0328:Arhgap39 UTSW 15 76,636,152 (GRCm39) splice site probably benign
R0432:Arhgap39 UTSW 15 76,619,086 (GRCm39) missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76,619,086 (GRCm39) missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76,619,086 (GRCm39) missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76,619,086 (GRCm39) missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76,635,759 (GRCm39) missense probably benign
R1830:Arhgap39 UTSW 15 76,619,383 (GRCm39) missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76,609,346 (GRCm39) missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76,609,585 (GRCm39) missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76,636,088 (GRCm39) missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76,609,712 (GRCm39) unclassified probably benign
R4626:Arhgap39 UTSW 15 76,621,837 (GRCm39) missense possibly damaging 0.92
R4790:Arhgap39 UTSW 15 76,610,931 (GRCm39) missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76,625,717 (GRCm39) missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76,622,005 (GRCm39) missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76,609,715 (GRCm39) unclassified probably benign
R5417:Arhgap39 UTSW 15 76,619,301 (GRCm39) missense possibly damaging 0.80
R5443:Arhgap39 UTSW 15 76,682,125 (GRCm39) intron probably benign
R5521:Arhgap39 UTSW 15 76,649,694 (GRCm39) missense possibly damaging 0.66
R5747:Arhgap39 UTSW 15 76,625,735 (GRCm39) missense possibly damaging 0.68
R5785:Arhgap39 UTSW 15 76,621,618 (GRCm39) missense probably benign
R5879:Arhgap39 UTSW 15 76,636,007 (GRCm39) missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76,621,424 (GRCm39) nonsense probably null
R6035:Arhgap39 UTSW 15 76,621,424 (GRCm39) nonsense probably null
R6049:Arhgap39 UTSW 15 76,611,601 (GRCm39) critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76,614,606 (GRCm39) nonsense probably null
R6232:Arhgap39 UTSW 15 76,620,712 (GRCm39) missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76,621,736 (GRCm39) missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76,619,337 (GRCm39) missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76,621,902 (GRCm39) missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76,621,699 (GRCm39) missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76,649,691 (GRCm39) missense probably benign 0.09
R7447:Arhgap39 UTSW 15 76,649,797 (GRCm39) start gained probably benign
R7658:Arhgap39 UTSW 15 76,621,617 (GRCm39) missense probably benign 0.03
R8071:Arhgap39 UTSW 15 76,621,702 (GRCm39) missense probably benign
R8269:Arhgap39 UTSW 15 76,635,942 (GRCm39) missense probably benign 0.35
R8368:Arhgap39 UTSW 15 76,619,455 (GRCm39) missense probably damaging 1.00
R9124:Arhgap39 UTSW 15 76,619,467 (GRCm39) missense probably damaging 1.00
R9333:Arhgap39 UTSW 15 76,619,325 (GRCm39) missense probably damaging 1.00
R9438:Arhgap39 UTSW 15 76,636,118 (GRCm39) missense probably damaging 0.96
R9602:Arhgap39 UTSW 15 76,610,954 (GRCm39) missense probably damaging 0.98
R9615:Arhgap39 UTSW 15 76,621,438 (GRCm39) missense probably benign 0.02
R9700:Arhgap39 UTSW 15 76,611,617 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTGTCTTTATTGGCCATGAC -3'
(R):5'- TTCACAGGGCCTGAAGAAGC -3'

Sequencing Primer
(F):5'- TTATTGGCCATGACCTACTCTAG -3'
(R):5'- GGCCTGAAGAAGCCTAATGTG -3'
Posted On 2016-11-09