Incidental Mutation 'R5686:N6amt1'
ID 443390
Institutional Source Beutler Lab
Gene Symbol N6amt1
Ensembl Gene ENSMUSG00000044442
Gene Name N-6 adenine-specific DNA methyltransferase 1 (putative)
Synonyms Hemk2, Pred28, 5830445C04Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5686 (G1)
Quality Score 95
Status Validated
Chromosome 16
Chromosomal Location 87354185-87368742 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87354335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 28 (D28V)
Ref Sequence ENSEMBL: ENSMUSP00000112510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054442] [ENSMUST00000118115] [ENSMUST00000118310] [ENSMUST00000120284]
AlphaFold Q6SKR2
Predicted Effect probably damaging
Transcript: ENSMUST00000054442
AA Change: D28V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061835
Gene: ENSMUSG00000044442
AA Change: D28V

DomainStartEndE-ValueType
Pfam:MTS 26 202 4.2e-12 PFAM
Pfam:Methyltransf_26 45 175 6.7e-15 PFAM
Pfam:Methyltransf_31 45 213 5.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118115
AA Change: D28V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113217
Gene: ENSMUSG00000044442
AA Change: D28V

DomainStartEndE-ValueType
Pfam:MTS 21 179 2e-14 PFAM
Pfam:Methyltransf_26 46 175 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118310
AA Change: D28V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113229
Gene: ENSMUSG00000044442
AA Change: D28V

DomainStartEndE-ValueType
Pfam:MTS 20 137 1.7e-12 PFAM
Pfam:PrmA 27 123 6.9e-7 PFAM
Pfam:Methyltransf_26 45 137 2.7e-13 PFAM
Pfam:Methyltransf_25 49 138 6.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120284
AA Change: D28V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112510
Gene: ENSMUSG00000044442
AA Change: D28V

DomainStartEndE-ValueType
Pfam:MTS 20 150 3.4e-12 PFAM
Pfam:PrmA 27 123 1.4e-6 PFAM
Pfam:Methyltransf_26 46 148 1.4e-12 PFAM
Pfam:Methyltransf_25 49 147 1.7e-7 PFAM
Meta Mutation Damage Score 0.8698 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele fail to form a primitive streak and die between E7.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in N6amt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1079:N6amt1 UTSW 16 87356198 missense probably damaging 0.98
R3028:N6amt1 UTSW 16 87362648 missense probably benign 0.00
R4692:N6amt1 UTSW 16 87356966 missense possibly damaging 0.65
R5324:N6amt1 UTSW 16 87354353 missense probably damaging 1.00
R7001:N6amt1 UTSW 16 87354292 missense probably benign 0.30
R7223:N6amt1 UTSW 16 87362660 makesense probably null
R7419:N6amt1 UTSW 16 87367566 missense possibly damaging 0.63
R8084:N6amt1 UTSW 16 87354340 missense probably damaging 1.00
R9434:N6amt1 UTSW 16 87362533 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGAAAACGGATGTTAGAGGTTGC -3'
(R):5'- TCTGCTGTCAATCACCAGAAAG -3'

Sequencing Primer
(F):5'- GTTGCTTAAAAGTTCCAGAGAGCCC -3'
(R):5'- GCTGTCAATCACCAGAAAGTAGGC -3'
Posted On 2016-11-09