Incidental Mutation 'R5686:Htr7'
ID 443397
Institutional Source Beutler Lab
Gene Symbol Htr7
Ensembl Gene ENSMUSG00000024798
Gene Name 5-hydroxytryptamine (serotonin) receptor 7
Synonyms 5-HT7
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5686 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 35958734-36057507 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 35969871 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 248 (A248S)
Ref Sequence ENSEMBL: ENSMUSP00000131517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]
AlphaFold P32304
Predicted Effect probably damaging
Transcript: ENSMUST00000099505
AA Change: A248S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798
AA Change: A248S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164639
AA Change: A248S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798
AA Change: A248S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 1.3e-9 PFAM
Pfam:7tm_1 101 387 1.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164781
SMART Domains Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 185 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165215
SMART Domains Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 183 7.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166074
AA Change: A248S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798
AA Change: A248S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.7e-9 PFAM
Pfam:7tm_1 101 387 5.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170360
AA Change: A248S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798
AA Change: A248S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 247 9.6e-9 PFAM
Pfam:7tm_1 101 252 1.4e-49 PFAM
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Htr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Htr7 APN 19 35960362 missense probably benign 0.00
R0009:Htr7 UTSW 19 36041540 intron probably benign
R0318:Htr7 UTSW 19 35969486 missense probably damaging 1.00
R1695:Htr7 UTSW 19 35969736 missense probably benign 0.01
R2316:Htr7 UTSW 19 35969303 critical splice donor site probably null
R3973:Htr7 UTSW 19 36056760 missense probably damaging 1.00
R5041:Htr7 UTSW 19 36057067 missense probably benign 0.10
R5203:Htr7 UTSW 19 35964392 missense probably benign 0.00
R5236:Htr7 UTSW 19 36056769 missense probably damaging 1.00
R5538:Htr7 UTSW 19 35969835 missense probably benign 0.34
R5682:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5683:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5684:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5694:Htr7 UTSW 19 36057121 missense probably benign 0.00
R6273:Htr7 UTSW 19 36041569 intron probably benign
R6502:Htr7 UTSW 19 35969610 missense probably damaging 1.00
R6558:Htr7 UTSW 19 36057240 missense probably damaging 1.00
R6884:Htr7 UTSW 19 35964379 critical splice donor site probably null
R7074:Htr7 UTSW 19 36056883 missense probably damaging 0.99
R7592:Htr7 UTSW 19 36056892 missense probably damaging 1.00
R9067:Htr7 UTSW 19 36057090 missense probably benign
R9338:Htr7 UTSW 19 35964380 critical splice donor site probably null
R9783:Htr7 UTSW 19 35969387 missense probably damaging 1.00
X0064:Htr7 UTSW 19 36056755 missense possibly damaging 0.70
Z1176:Htr7 UTSW 19 35969423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTTTGAGCAGTCTCGAAAG -3'
(R):5'- GCTAGGTACCTTGGGATCAC -3'

Sequencing Primer
(F):5'- GAAAGGTTCGCACACTCTTC -3'
(R):5'- GGATCACCAGGCCCCTCAC -3'
Posted On 2016-11-09