Incidental Mutation 'R5687:Olfr1285'
ID443404
Institutional Source Beutler Lab
Gene Symbol Olfr1285
Ensembl Gene ENSMUSG00000062280
Gene Nameolfactory receptor 1285
SynonymsMOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111408376-111409331 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 111408688 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000184954]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184954
AA Change: *105R
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: *105R

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220153
Meta Mutation Damage Score 0.3432 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Olfr1285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1285 APN 2 111409219 missense probably damaging 1.00
IGL01819:Olfr1285 APN 2 111408733 missense probably damaging 0.99
IGL02109:Olfr1285 APN 2 111408493 exon noncoding transcript
IGL02407:Olfr1285 APN 2 111408578 exon noncoding transcript
R0054:Olfr1285 UTSW 2 111408795 missense probably benign 0.00
R1665:Olfr1285 UTSW 2 111408753 missense probably damaging 1.00
R2339:Olfr1285 UTSW 2 111409189 missense probably benign 0.36
R3876:Olfr1285 UTSW 2 111408622 missense possibly damaging 0.57
R4260:Olfr1285 UTSW 2 111408505 exon noncoding transcript
R4439:Olfr1285 UTSW 2 111409308 exon noncoding transcript
R4762:Olfr1285 UTSW 2 111408880 exon noncoding transcript
R4821:Olfr1285 UTSW 2 111409225 exon noncoding transcript
R5120:Olfr1285 UTSW 2 111409240 exon noncoding transcript
R5215:Olfr1285 UTSW 2 111409286 exon noncoding transcript
R5244:Olfr1285 UTSW 2 111408554 exon noncoding transcript
R5667:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5671:Olfr1285 UTSW 2 111408473 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGCAACTTGAGATCTTCCTCTTAC -3'
(R):5'- GACTAATGGCATGCACAAATCC -3'

Sequencing Primer
(F):5'- TCCTCTATCTGATGACTTTGGTAG -3'
(R):5'- TAATGGCATGCACAAATCCAACAATC -3'
Posted On2016-11-09