Incidental Mutation 'R5687:Col11a1'
ID443409
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 114217103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000184978]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: S1723P
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: S1723P

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184978
SMART Domains Protein: ENSMUSP00000138879
Gene: ENSMUSG00000027966

DomainStartEndE-ValueType
Pfam:Collagen 1 57 6.3e-10 PFAM
Pfam:Collagen 49 110 3.2e-10 PFAM
Pfam:Collagen 95 165 6.2e-8 PFAM
Pfam:Collagen 242 318 2.2e-9 PFAM
Pfam:Collagen 289 362 1.6e-7 PFAM
Pfam:Collagen 341 403 2e-9 PFAM
COLFI 434 536 8.88e-12 SMART
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
uncovered UTSW 3 114112467 unclassified probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0144:Col11a1 UTSW 3 114113594 missense unknown
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1338:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R3970:Col11a1 UTSW 3 114097189 missense unknown
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6738:Col11a1 UTSW 3 114112467 unclassified probably benign
R6747:Col11a1 UTSW 3 114212450 nonsense probably null
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
R7201:Col11a1 UTSW 3 114090157 missense unknown
R7264:Col11a1 UTSW 3 114185599 missense unknown
R7393:Col11a1 UTSW 3 114097106 missense unknown
R7445:Col11a1 UTSW 3 114193929 missense unknown
R7479:Col11a1 UTSW 3 114102569 missense unknown
R7548:Col11a1 UTSW 3 114123760 missense unknown
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTAGGATCACCAAGACCTGG -3'
(R):5'- AGAGTATCTTATGTGCATGTGCC -3'

Sequencing Primer
(F):5'- TGGCAGCCGCATTCACAG -3'
(R):5'- CATGTGCCTTGGTAGTTTCCAATATG -3'
Posted On2016-11-09