Incidental Mutation 'R5687:Nasp'
ID443413
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 116605805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]
Predicted Effect probably benign
Transcript: ENSMUST00000030456
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030457
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081182
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155398
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1707:Nasp UTSW 4 116618936 missense probably damaging 0.99
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R4983:Nasp UTSW 4 116602185 missense probably damaging 0.99
R5064:Nasp UTSW 4 116611970 critical splice donor site probably null
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6145:Nasp UTSW 4 116611077 missense probably benign 0.19
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6483:Nasp UTSW 4 116618948 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
R8166:Nasp UTSW 4 116610915 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCAAGGACCAGATCTTACAGGAATC -3'
(R):5'- CACGTCTGACATTTGGATGAATG -3'

Sequencing Primer
(F):5'- TTTCCTATATTAGCAACCCATAACCC -3'
(R):5'- TGGATGAATGTACTATAAGGCTGTG -3'
Posted On2016-11-09