Mutagenetix > Incidental Mutations

Incidental Mutation 'R5687:Nasp'

443413

Institutional Source

Beutler Lab

Gene Symbol

Nasp

Ensembl Gene

ENSMUSG00000028693

Gene Name

nuclear autoantigenic sperm protein (histone-binding)

Synonyms

D4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T

MMRRC Submission

043320-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5687 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116601052-116627941 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 116605805 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000079946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]

Predicted Effect

probably benign
Transcript: ENSMUST00000030456

SMART Domains

Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	8.51e0	SMART
low complexity region	111	126	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
low complexity region	336	352	N/A	INTRINSIC
low complexity region	455	478	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
TPR	528	561	3.05e0	SMART
TPR	570	603	2.38e-2	SMART
low complexity region	620	640	N/A	INTRINSIC
low complexity region	703	715	N/A	INTRINSIC
low complexity region	742	759	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000030457

SMART Domains

Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	8.51e0	SMART
low complexity region	111	126	N/A	INTRINSIC
low complexity region	133	153	N/A	INTRINSIC
low complexity region	167	178	N/A	INTRINSIC
TPR	203	236	3.05e0	SMART
TPR	245	278	2.38e-2	SMART
low complexity region	295	315	N/A	INTRINSIC
low complexity region	378	390	N/A	INTRINSIC
low complexity region	417	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081182

SMART Domains

Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	6.2e-2	SMART
low complexity region	84	99	N/A	INTRINSIC
low complexity region	106	126	N/A	INTRINSIC
low complexity region	140	151	N/A	INTRINSIC
TPR	176	209	1.4e-2	SMART
TPR	218	251	1.1e-4	SMART
low complexity region	268	288	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
low complexity region	390	407	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155398

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	T	A	15: 94,325,971	D1292V	probably benign	Het
Adcy2	A	T	13: 68,620,819	C1063*	probably null	Het
Adcy2	A	T	13: 68,642,569	V892D	probably damaging	Het
Agtpbp1	T	C	13: 59,500,515	D497G	probably benign	Het
Anks1b	A	C	10: 90,914,711	I195L	probably benign	Het
Asmt	G	T	X: 170,678,016	S377I	unknown	Het
C1s1	T	A	6: 124,540,950	T24S	probably benign	Het
Ccdc85a	A	T	11: 28,392,854		probably benign	Het
Ccndbp1	T	C	2: 121,014,702		probably benign	Het
Cct8	T	C	16: 87,488,821	I250V	probably benign	Het
Cmya5	T	C	13: 93,098,176	T135A	possibly damaging	Het
Col11a1	T	C	3: 114,217,103		probably benign	Het
Crybg3	A	G	16: 59,559,166	M575T	probably benign	Het
Dmp1	C	T	5: 104,207,086		probably benign	Het
Emc1	G	T	4: 139,375,380	R950L	probably damaging	Het
Enpep	T	C	3: 129,299,094		probably null	Het
Eya1	G	A	1: 14,183,252	T500I	probably damaging	Het
Fam169a	T	C	13: 97,093,618	F54L	probably damaging	Het
Fbxo8	A	G	8: 56,591,517	K285R	probably damaging	Het
Galnt1	A	T	18: 24,272,750	E416D	probably benign	Het
Gcc1	T	A	6: 28,419,233		probably null	Het
Gm10800	T	A	2: 98,666,620	Y196F	probably benign	Het
Gmpr	T	A	13: 45,539,020		probably null	Het
Jrkl	C	T	9: 13,244,382	E425K	probably benign	Het
Kl	T	G	5: 150,988,466	I560S	possibly damaging	Het
Kyat3	C	A	3: 142,734,582	R356S	probably null	Het
Lrig2	C	T	3: 104,464,072		probably null	Het
Lrrc47	A	G	4: 154,015,683	T239A	probably benign	Het
Map4k2	T	C	19: 6,345,642		probably benign	Het
Mon2	A	G	10: 123,008,239	S1469P	probably damaging	Het
Mthfd1l	G	A	10: 3,990,002		probably null	Het
Mvk	G	T	5: 114,450,765	G144V	probably damaging	Het
Ndst4	A	C	3: 125,438,609	N276H	possibly damaging	Het
Nsmf	C	T	2: 25,056,067	P189S	probably damaging	Het
Nt5m	T	G	11: 59,852,823	D92E	probably benign	Het
Olfr1198	A	T	2: 88,746,750	I46N	probably damaging	Het
Olfr1285	T	C	2: 111,408,688		noncoding transcript	Het
Olfr981	T	G	9: 40,022,435	L14R	probably damaging	Het
Pan3	T	A	5: 147,455,172	I119N	probably damaging	Het
Pard6b	A	T	2: 168,098,626	S178C	probably damaging	Het
Parl	A	G	16: 20,287,978		probably benign	Het
Pdk2	A	G	11: 95,029,025		probably benign	Het
Prag1	A	G	8: 36,146,813	E1173G	probably benign	Het
Prph2	T	A	17: 46,923,465	L320Q	probably damaging	Het
Psmd3	T	C	11: 98,693,669	I200T	probably damaging	Het
Rhbdd3	T	A	11: 5,105,707	S324T	probably damaging	Het
Rps6-ps2	A	T	8: 88,806,484		noncoding transcript	Het
Rps8	G	C	4: 117,155,155		probably benign	Het
Samd4	A	G	14: 47,016,565	N61S	probably benign	Het
Sfrp2	G	A	3: 83,766,839	A100T	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a13	A	G	6: 121,302,741	T25A	probably benign	Het
Sntg1	C	A	1: 8,463,443	R329L	possibly damaging	Het
Sorbs2	T	C	8: 45,775,632	F285L	probably damaging	Het
Speg	T	C	1: 75,419,129		probably null	Het
Srgap1	T	C	10: 121,825,636	Y533C	probably damaging	Het
Supt5	C	A	7: 28,317,763	S668I	probably benign	Het
Taf6l	T	G	19: 8,773,312	I133L	probably benign	Het
Tcrg-C1	A	T	13: 19,216,559	I153F	unknown	Het
Thrap3	G	A	4: 126,180,486		probably benign	Het
Tmem115	A	G	9: 107,534,855	N126S	probably benign	Het
Tspoap1	T	A	11: 87,777,126	I1192N	probably damaging	Het
Vcan	T	C	13: 89,678,134	I3184V	probably damaging	Het
Yeats4	G	A	10: 117,215,680	T224M	probably benign	Het
Zc3h13	A	T	14: 75,331,960	R1416*	probably null	Het
Zmynd12	T	A	4: 119,441,901	Y193N	probably damaging	Het

Other mutations in Nasp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Nasp	APN	4	116604219	missense	probably damaging	1.00
IGL00780:Nasp	APN	4	116603999	nonsense	probably null
IGL00833:Nasp	APN	4	116602736	missense	probably damaging	1.00
IGL02232:Nasp	APN	4	116604800	missense	probably damaging	0.99
R0023:Nasp	UTSW	4	116605771	splice site	probably benign
R0023:Nasp	UTSW	4	116605771	splice site	probably benign
R0179:Nasp	UTSW	4	116602157	missense	probably damaging	1.00
R0385:Nasp	UTSW	4	116610695	missense	probably benign	0.02
R1707:Nasp	UTSW	4	116618936	missense	probably damaging	0.99
R1945:Nasp	UTSW	4	116622768	missense	possibly damaging	0.62
R2061:Nasp	UTSW	4	116611126	missense	probably benign	0.12
R4983:Nasp	UTSW	4	116602185	missense	probably damaging	0.99
R5064:Nasp	UTSW	4	116611970	critical splice donor site	probably null
R5713:Nasp	UTSW	4	116614361	missense	probably benign	0.34
R5839:Nasp	UTSW	4	116602091	critical splice donor site	probably null
R6145:Nasp	UTSW	4	116611077	missense	probably benign	0.19
R6159:Nasp	UTSW	4	116603889	splice site	probably null
R6234:Nasp	UTSW	4	116622782	missense	possibly damaging	0.51
R6286:Nasp	UTSW	4	116604788	missense	probably damaging	1.00
R6483:Nasp	UTSW	4	116618948	missense	probably damaging	1.00
R6899:Nasp	UTSW	4	116604333	missense	probably damaging	1.00
R7276:Nasp	UTSW	4	116614349	missense	probably damaging	1.00
R7412:Nasp	UTSW	4	116610588	missense	possibly damaging	0.85
R7763:Nasp	UTSW	4	116612033	missense	probably benign	0.03
R8166:Nasp	UTSW	4	116610915	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- GCAAGGACCAGATCTTACAGGAATC -3'
(R):5'- CACGTCTGACATTTGGATGAATG -3'

Sequencing Primer
(F):5'- TTTCCTATATTAGCAACCCATAACCC -3'
(R):5'- TGGATGAATGTACTATAAGGCTGTG -3'

Posted On

2016-11-09