Incidental Mutation 'R5687:Emc1'
ID443417
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139375380 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 950 (R950L)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: R947L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R947L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: R950L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R950L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: R950L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R950L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181556
Meta Mutation Damage Score 0.7183 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCTGGAGTCCACTTGTTTGG -3'
(R):5'- TCAGGGATCCAACAGTCCAC -3'

Sequencing Primer
(F):5'- TTTGGTGAGTGGCCCCAC -3'
(R):5'- AGTCCACGGCCATCTCCTTAG -3'
Posted On2016-11-09