Incidental Mutation 'R5687:Slc6a13'
ID 443424
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission 043320-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R5687 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121279700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000120689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably benign
Transcript: ENSMUST00000064580
AA Change: T14A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: T14A

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142144
Predicted Effect probably benign
Transcript: ENSMUST00000142419
AA Change: T25A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108
AA Change: T25A

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,223,852 (GRCm39) D1292V probably benign Het
Adcy2 A T 13: 68,768,938 (GRCm39) C1063* probably null Het
Adcy2 A T 13: 68,790,688 (GRCm39) V892D probably damaging Het
Agtpbp1 T C 13: 59,648,329 (GRCm39) D497G probably benign Het
Anks1b A C 10: 90,750,573 (GRCm39) I195L probably benign Het
Asmt G T X: 169,111,749 (GRCm39) S377I unknown Het
C1s1 T A 6: 124,517,909 (GRCm39) T24S probably benign Het
Ccdc85a A T 11: 28,342,854 (GRCm39) probably benign Het
Ccndbp1 T C 2: 120,845,183 (GRCm39) probably benign Het
Cct8 T C 16: 87,285,709 (GRCm39) I250V probably benign Het
Cmya5 T C 13: 93,234,684 (GRCm39) T135A possibly damaging Het
Col11a1 T C 3: 114,010,752 (GRCm39) probably benign Het
Crybg3 A G 16: 59,379,529 (GRCm39) M575T probably benign Het
Dmp1 C T 5: 104,354,952 (GRCm39) probably benign Het
Emc1 G T 4: 139,102,691 (GRCm39) R950L probably damaging Het
Enpep T C 3: 129,092,743 (GRCm39) probably null Het
Eya1 G A 1: 14,253,476 (GRCm39) T500I probably damaging Het
Fam169a T C 13: 97,230,126 (GRCm39) F54L probably damaging Het
Fbxo8 A G 8: 57,044,552 (GRCm39) K285R probably damaging Het
Galnt1 A T 18: 24,405,807 (GRCm39) E416D probably benign Het
Gcc1 T A 6: 28,419,232 (GRCm39) probably null Het
Gm10800 T A 2: 98,496,965 (GRCm39) Y196F probably benign Het
Gmpr T A 13: 45,692,496 (GRCm39) probably null Het
Jrkl C T 9: 13,244,387 (GRCm39) E425K probably benign Het
Kl T G 5: 150,911,931 (GRCm39) I560S possibly damaging Het
Kyat3 C A 3: 142,440,343 (GRCm39) R356S probably null Het
Lrig2 C T 3: 104,371,388 (GRCm39) probably null Het
Lrrc47 A G 4: 154,100,140 (GRCm39) T239A probably benign Het
Map4k2 T C 19: 6,395,672 (GRCm39) probably benign Het
Mon2 A G 10: 122,844,144 (GRCm39) S1469P probably damaging Het
Mthfd1l G A 10: 3,940,002 (GRCm39) probably null Het
Mvk G T 5: 114,588,826 (GRCm39) G144V probably damaging Het
Nasp T A 4: 116,463,002 (GRCm39) probably benign Het
Ndst4 A C 3: 125,232,258 (GRCm39) N276H possibly damaging Het
Nsmf C T 2: 24,946,079 (GRCm39) P189S probably damaging Het
Nt5m T G 11: 59,743,649 (GRCm39) D92E probably benign Het
Or10g6 T G 9: 39,933,731 (GRCm39) L14R probably damaging Het
Or4k39 T C 2: 111,239,033 (GRCm39) noncoding transcript Het
Or4p23 A T 2: 88,577,094 (GRCm39) I46N probably damaging Het
Pan3 T A 5: 147,391,982 (GRCm39) I119N probably damaging Het
Pard6b A T 2: 167,940,546 (GRCm39) S178C probably damaging Het
Parl A G 16: 20,106,728 (GRCm39) probably benign Het
Pdk2 A G 11: 94,919,851 (GRCm39) probably benign Het
Prag1 A G 8: 36,613,967 (GRCm39) E1173G probably benign Het
Prph2 T A 17: 47,234,391 (GRCm39) L320Q probably damaging Het
Psmd3 T C 11: 98,584,495 (GRCm39) I200T probably damaging Het
Rhbdd3 T A 11: 5,055,707 (GRCm39) S324T probably damaging Het
Rps6-ps2 A T 8: 89,533,112 (GRCm39) noncoding transcript Het
Rps8 G C 4: 117,012,352 (GRCm39) probably benign Het
Samd4 A G 14: 47,254,022 (GRCm39) N61S probably benign Het
Sfrp2 G A 3: 83,674,146 (GRCm39) A100T probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Sntg1 C A 1: 8,533,667 (GRCm39) R329L possibly damaging Het
Sorbs2 T C 8: 46,228,669 (GRCm39) F285L probably damaging Het
Speg T C 1: 75,395,773 (GRCm39) probably null Het
Srgap1 T C 10: 121,661,541 (GRCm39) Y533C probably damaging Het
Supt5 C A 7: 28,017,188 (GRCm39) S668I probably benign Het
Taf6l T G 19: 8,750,676 (GRCm39) I133L probably benign Het
Thrap3 G A 4: 126,074,279 (GRCm39) probably benign Het
Tmem115 A G 9: 107,412,054 (GRCm39) N126S probably benign Het
Trgc1 A T 13: 19,400,729 (GRCm39) I153F unknown Het
Tspoap1 T A 11: 87,667,952 (GRCm39) I1192N probably damaging Het
Vcan T C 13: 89,826,253 (GRCm39) I3184V probably damaging Het
Yeats4 G A 10: 117,051,585 (GRCm39) T224M probably benign Het
Zc3h13 A T 14: 75,569,400 (GRCm39) R1416* probably null Het
Zmynd12 T A 4: 119,299,098 (GRCm39) Y193N probably damaging Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AACAGGCAATCCTAGGAGCTC -3'
(R):5'- AGACTGGGTAGCACTATGGCTC -3'

Sequencing Primer
(F):5'- TCCCCAGCTCTGCCAGTG -3'
(R):5'- GGTAGCACTATGGCTCTCACC -3'
Posted On 2016-11-09