Incidental Mutation 'R5688:Patj'
ID443484
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 043321-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 98520810 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 34 (K34*)
Ref Sequence ENSEMBL: ENSMUSP00000115936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107029] [ENSMUST00000107033] [ENSMUST00000107034] [ENSMUST00000134901]
Predicted Effect probably null
Transcript: ENSMUST00000041284
AA Change: K1097*
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: K1097*

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107029
AA Change: K524*
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: K524*

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107033
AA Change: K765*
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: K765*

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107034
AA Change: K1093*
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: K1093*

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134901
AA Change: K34*
SMART Domains Protein: ENSMUSP00000115936
Gene: ENSMUSG00000061859
AA Change: K34*

DomainStartEndE-ValueType
PDZ 20 103 8.65e-19 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R7953:Patj UTSW 4 98424316 missense probably damaging 1.00
R7966:Patj UTSW 4 98611135 missense probably benign 0.00
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCTAGCCTCATTTATCCAGC -3'
(R):5'- AAGTTGGCCCAAGTGATTCTTTTG -3'

Sequencing Primer
(F):5'- CCAGCATCTCTAAAGTGCATTAGG -3'
(R):5'- GGCCCAAGTGATTCTTTTGCTGAC -3'
Posted On2016-11-09