Incidental Mutation 'R5688:Oas3'
ID443488
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5688 (G1)
Quality Score218
Status Not validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120758802 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 918 (N918S)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000165820]
Predicted Effect probably benign
Transcript: ENSMUST00000044833
AA Change: N918S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: N918S

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165820
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200795
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T A 2: 76,879,984 probably null Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTGCACAGTTCCCTACAGC -3'
(R):5'- ACTGGTTATAGGACGCCAAAG -3'

Sequencing Primer
(F):5'- AGTTCCCTACAGCTGCCCAG -3'
(R):5'- AAAGGGCACTTCAGGGCTC -3'
Posted On2016-11-09