Incidental Mutation 'R5688:Slc29a4'
ID443489
Institutional Source Beutler Lab
Gene Symbol Slc29a4
Ensembl Gene ENSMUSG00000050822
Gene Namesolute carrier family 29 (nucleoside transporters), member 4
SynonymsmPMAT, ENT4
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5688 (G1)
Quality Score218
Status Not validated
Chromosome5
Chromosomal Location142692512-142722490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142714098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 168 (I168T)
Ref Sequence ENSEMBL: ENSMUSP00000059896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058418] [ENSMUST00000198728]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058418
AA Change: I168T

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: I168T

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Nucleoside_tran 170 501 2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198728
SMART Domains Protein: ENSMUSP00000142674
Gene: ENSMUSG00000050822

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Slc29a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Slc29a4 APN 5 142705530 missense probably benign 0.02
IGL01717:Slc29a4 APN 5 142718746 missense probably damaging 1.00
IGL02184:Slc29a4 APN 5 142717751 missense probably damaging 1.00
IGL02207:Slc29a4 APN 5 142718885 missense possibly damaging 0.76
IGL02210:Slc29a4 APN 5 142718779 missense probably damaging 1.00
IGL02323:Slc29a4 APN 5 142717652 missense probably damaging 0.99
IGL02381:Slc29a4 APN 5 142720099 missense probably benign 0.34
IGL03103:Slc29a4 APN 5 142712080 missense probably damaging 1.00
IGL03210:Slc29a4 APN 5 142715108 missense probably damaging 1.00
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0132:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0850:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R1777:Slc29a4 UTSW 5 142714062 missense probably damaging 0.96
R1864:Slc29a4 UTSW 5 142717754 missense probably damaging 1.00
R1870:Slc29a4 UTSW 5 142721488 makesense probably null
R1871:Slc29a4 UTSW 5 142721488 makesense probably null
R2092:Slc29a4 UTSW 5 142718855 missense probably damaging 1.00
R2196:Slc29a4 UTSW 5 142712895 missense possibly damaging 0.94
R4716:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R5002:Slc29a4 UTSW 5 142718746 missense probably damaging 1.00
R5162:Slc29a4 UTSW 5 142721452 missense possibly damaging 0.80
R5235:Slc29a4 UTSW 5 142718768 missense probably damaging 1.00
R5553:Slc29a4 UTSW 5 142720036 missense probably damaging 1.00
R5642:Slc29a4 UTSW 5 142711972 missense probably damaging 1.00
R5930:Slc29a4 UTSW 5 142721402 missense possibly damaging 0.90
R5944:Slc29a4 UTSW 5 142718818 missense probably damaging 1.00
R6056:Slc29a4 UTSW 5 142720077 missense probably damaging 0.99
R6409:Slc29a4 UTSW 5 142712071 missense probably damaging 1.00
R6934:Slc29a4 UTSW 5 142712958 missense probably benign 0.02
R7508:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7509:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7716:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7910:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
R7991:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGTAGGCATGATGTCTG -3'
(R):5'- AGAGTGACCTTAGTGTATGTGACG -3'

Sequencing Primer
(F):5'- AGGCATGATGTCTGAGATTTACCTC -3'
(R):5'- ACGGTCTGTGTGCATGCAC -3'
Posted On2016-11-09