Incidental Mutation 'R5688:Mgst1'
ID443493
Institutional Source Beutler Lab
Gene Symbol Mgst1
Ensembl Gene ENSMUSG00000008540
Gene Namemicrosomal glutathione S-transferase 1
Synonyms
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location138140316-138156755 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 138141800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008684] [ENSMUST00000118091] [ENSMUST00000120230] [ENSMUST00000120302] [ENSMUST00000120939] [ENSMUST00000125810] [ENSMUST00000140932] [ENSMUST00000204628]
Predicted Effect probably benign
Transcript: ENSMUST00000008684
SMART Domains Protein: ENSMUSP00000008684
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000118091
AA Change: F37L
SMART Domains Protein: ENSMUSP00000112923
Gene: ENSMUSG00000008540
AA Change: F37L

DomainStartEndE-ValueType
Pfam:MAPEG 90 224 1.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120230
SMART Domains Protein: ENSMUSP00000113859
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120302
SMART Domains Protein: ENSMUSP00000113257
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120939
SMART Domains Protein: ENSMUSP00000112646
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
PDB:2H8A|A 2 74 1e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125810
SMART Domains Protein: ENSMUSP00000114222
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
PDB:2H8A|A 42 92 6e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140932
SMART Domains Protein: ENSMUSP00000145306
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 1 46 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204628
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Mgst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Mgst1 APN 6 138147768 missense probably damaging 0.99
R0319:Mgst1 UTSW 6 138156157 missense possibly damaging 0.81
R0613:Mgst1 UTSW 6 138156245 missense probably damaging 1.00
R0634:Mgst1 UTSW 6 138156331 missense probably damaging 1.00
R0730:Mgst1 UTSW 6 138147669 missense probably benign 0.03
R0862:Mgst1 UTSW 6 138147751 missense probably damaging 1.00
R4447:Mgst1 UTSW 6 138141664 intron probably benign
R4569:Mgst1 UTSW 6 138156215 missense probably damaging 0.99
R4644:Mgst1 UTSW 6 138156370 missense probably damaging 1.00
R4701:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R4930:Mgst1 UTSW 6 138153509 missense probably benign 0.00
R6307:Mgst1 UTSW 6 138150829 missense probably benign 0.44
R6468:Mgst1 UTSW 6 138141587 unclassified probably null
R6697:Mgst1 UTSW 6 138147753 missense probably damaging 1.00
R6741:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R6755:Mgst1 UTSW 6 138147772 missense probably damaging 0.99
R6791:Mgst1 UTSW 6 138141807 intron probably benign
R7295:Mgst1 UTSW 6 138147756 missense probably benign 0.11
R7440:Mgst1 UTSW 6 138150844 missense probably benign
R7532:Mgst1 UTSW 6 138153506 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CACTGGGGCAAAATATGACAAC -3'
(R):5'- AAGTGTTTGTAGCTCAGTGCC -3'

Sequencing Primer
(F):5'- CAGGAGTTACAGGAGAAGCTTCC -3'
(R):5'- TTGTAGCTCAGTGCCTGGCC -3'
Posted On2016-11-09