Incidental Mutation 'R5688:Ovch2'
ID443505
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107793994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 224 (L224P)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: L224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: L224P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R7924:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7989:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATAATGAGTGGAGAACCTTG -3'
(R):5'- AAACTTGCATCCAGCTGGTG -3'

Sequencing Primer
(F):5'- TGGAGAACCTTGAGGGCTTCAC -3'
(R):5'- CTGATGAAAGTACAGGGCGTCTTC -3'
Posted On2016-11-09