Incidental Mutation 'R5688:Olfr145'
ID443511
Institutional Source Beutler Lab
Gene Symbol Olfr145
Ensembl Gene ENSMUSG00000066748
Gene Nameolfactory receptor 145
SynonymsK21, MOR161-6, GA_x6K02T2PVTD-31578734-31579666
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37896724-37903519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37898063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 220 (I220L)
Ref Sequence ENSEMBL: ENSMUSP00000150284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086062] [ENSMUST00000213688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086062
AA Change: I220L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083229
Gene: ENSMUSG00000066748
AA Change: I220L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-51 PFAM
Pfam:7tm_1 40 289 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213688
AA Change: I220L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Olfr145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr145 APN 9 37898063 missense probably benign 0.13
IGL01586:Olfr145 APN 9 37897976 missense possibly damaging 0.73
IGL02185:Olfr145 APN 9 37898235 missense probably damaging 1.00
IGL02895:Olfr145 APN 9 37897982 missense probably benign 0.01
IGL02956:Olfr145 APN 9 37898108 missense probably damaging 1.00
R0391:Olfr145 UTSW 9 37897842 missense probably benign 0.31
R0513:Olfr145 UTSW 9 37898055 missense probably damaging 1.00
R4600:Olfr145 UTSW 9 37898326 missense probably benign
R4610:Olfr145 UTSW 9 37898326 missense probably benign
R4611:Olfr145 UTSW 9 37898326 missense probably benign
R4982:Olfr145 UTSW 9 37897515 missense probably damaging 1.00
R5574:Olfr145 UTSW 9 37897581 missense probably damaging 1.00
R5608:Olfr145 UTSW 9 37897782 missense probably damaging 0.98
R5906:Olfr145 UTSW 9 37897878 missense probably damaging 1.00
R6286:Olfr145 UTSW 9 37897778 missense probably damaging 0.99
R7138:Olfr145 UTSW 9 37898064 missense probably damaging 0.99
R7145:Olfr145 UTSW 9 37897563 missense probably benign 0.01
R8046:Olfr145 UTSW 9 37897389 splice site probably benign
X0012:Olfr145 UTSW 9 37898328 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACACCGTGACCATGTCTCC -3'
(R):5'- AAGGACGACACTTTCCCCTG -3'

Sequencing Primer
(F):5'- AGCATTCATGGTGAAACTGACC -3'
(R):5'- TTCCCCTGGTTCATAGGCAAAAGG -3'
Posted On2016-11-09