Incidental Mutation 'R5688:Lca5'
ID443513
Institutional Source Beutler Lab
Gene Symbol Lca5
Ensembl Gene ENSMUSG00000032258
Gene NameLeber congenital amaurosis 5 (human)
Synonyms4930431B11Rik, 5730406O13Rik, ORF64
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location83390293-83441127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83398566 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 394 (D394Y)
Ref Sequence ENSEMBL: ENSMUSP00000140753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]
Predicted Effect probably benign
Transcript: ENSMUST00000034791
AA Change: D394Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: D394Y

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 103 295 2.6e-66 PFAM
low complexity region 306 315 N/A INTRINSIC
low complexity region 617 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034793
AA Change: D394Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: D394Y

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 4.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190514
AA Change: D394Y

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: D394Y

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 5.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191225
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T A 2: 76,879,984 probably null Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Lca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Lca5 APN 9 83395475 missense probably damaging 0.98
IGL01349:Lca5 APN 9 83426617 missense probably damaging 1.00
IGL01918:Lca5 APN 9 83423148 missense probably damaging 1.00
IGL02035:Lca5 APN 9 83423312 missense probably damaging 1.00
IGL02276:Lca5 APN 9 83398585 missense possibly damaging 0.79
IGL02425:Lca5 APN 9 83399721 missense probably damaging 1.00
IGL02481:Lca5 APN 9 83423117 missense probably damaging 1.00
IGL02483:Lca5 APN 9 83423117 missense probably damaging 1.00
R0465:Lca5 UTSW 9 83395867 nonsense probably null
R0610:Lca5 UTSW 9 83399739 missense probably benign 0.24
R0811:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0812:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0968:Lca5 UTSW 9 83423169 missense probably benign 0.01
R1891:Lca5 UTSW 9 83395608 missense probably damaging 1.00
R5223:Lca5 UTSW 9 83398613 missense probably benign 0.00
R5235:Lca5 UTSW 9 83423054 nonsense probably null
R5260:Lca5 UTSW 9 83423223 missense probably damaging 0.98
R5531:Lca5 UTSW 9 83398595 missense probably benign 0.00
R5558:Lca5 UTSW 9 83401743 missense probably damaging 0.99
R5886:Lca5 UTSW 9 83399681 missense probably benign 0.31
R6426:Lca5 UTSW 9 83395654 nonsense probably null
R7108:Lca5 UTSW 9 83423169 missense probably benign 0.25
R7151:Lca5 UTSW 9 83398640 missense probably benign 0.20
R7314:Lca5 UTSW 9 83395510 missense possibly damaging 0.86
R7378:Lca5 UTSW 9 83395530 missense probably benign 0.00
R7468:Lca5 UTSW 9 83423456 missense probably damaging 0.99
R7686:Lca5 UTSW 9 83395239 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCGATAGTAACTTGTAGTCTTCG -3'
(R):5'- ACTGGGTGATCATGCTTCATGG -3'

Sequencing Primer
(F):5'- GGCTCTATTCAGCTGTTCAGAC -3'
(R):5'- ACAGTACCTGGAGTACCA -3'
Posted On2016-11-09