Incidental Mutation 'R5688:Atp10b'
ID 443515
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission 043321-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5688 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43092000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 345 (H345L)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably benign
Transcript: ENSMUST00000077659
AA Change: H345L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: H345L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137991
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,315,920 (GRCm39) A222V probably benign Het
Ahnak A G 19: 8,979,883 (GRCm39) D389G probably benign Het
Aldh1l2 A T 10: 83,337,789 (GRCm39) S559T possibly damaging Het
Alms1 T A 6: 85,576,877 (GRCm39) N144K possibly damaging Het
Anp32b T A 4: 46,469,868 (GRCm39) probably null Het
Atf7 C T 15: 102,459,944 (GRCm39) R57H probably damaging Het
Cacna2d1 A T 5: 16,563,950 (GRCm39) I859F probably damaging Het
Calcr T A 6: 3,714,730 (GRCm39) probably null Het
Cd248 A G 19: 5,119,963 (GRCm39) T604A probably benign Het
Cemip C T 7: 83,610,849 (GRCm39) V702M probably damaging Het
Cep295 G T 9: 15,243,282 (GRCm39) Q469K probably damaging Het
Cntn5 A G 9: 9,748,427 (GRCm39) W485R probably damaging Het
Cpe T C 8: 65,062,189 (GRCm39) N289S possibly damaging Het
Cyp2j11 G A 4: 96,233,358 (GRCm39) R113C probably damaging Het
Dcp1b T C 6: 119,194,872 (GRCm39) S531P probably benign Het
Defb7 T G 8: 19,545,167 (GRCm39) L15R probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Ednrb T C 14: 104,060,831 (GRCm39) D198G probably damaging Het
Engase A C 11: 118,378,146 (GRCm39) E312A possibly damaging Het
Evl G A 12: 108,639,612 (GRCm39) probably null Het
Faf1 C A 4: 109,652,010 (GRCm39) Q234K probably damaging Het
Garre1 T A 7: 33,953,416 (GRCm39) T449S possibly damaging Het
Garre1 T G 7: 33,984,134 (GRCm39) D163A probably damaging Het
Gm5460 C A 14: 33,767,752 (GRCm39) N453K possibly damaging Het
Gm7356 T A 17: 14,220,869 (GRCm39) I387F possibly damaging Het
H1f2 A G 13: 23,923,148 (GRCm39) K106R probably damaging Het
Hagh T C 17: 25,069,568 (GRCm39) M1T probably null Het
Hars1 A T 18: 36,905,369 (GRCm39) V155E probably damaging Het
Lca5 C A 9: 83,280,619 (GRCm39) D394Y probably benign Het
Lmtk3 T C 7: 45,440,834 (GRCm39) L280P probably damaging Het
Lrit1 C T 14: 36,784,385 (GRCm39) A571V possibly damaging Het
Map4k2 C A 19: 6,396,836 (GRCm39) P584H probably damaging Het
Mgst1 T C 6: 138,118,798 (GRCm39) probably benign Het
Mtrex A T 13: 113,009,590 (GRCm39) C936* probably null Het
Neb C T 2: 52,086,339 (GRCm39) V5245I probably damaging Het
Oas3 T C 5: 120,896,867 (GRCm39) N918S probably benign Het
Or4c106 C T 2: 88,683,023 (GRCm39) T243I probably benign Het
Or5d16 T A 2: 87,773,552 (GRCm39) Q140L probably benign Het
Or8b8 A C 9: 37,809,359 (GRCm39) I220L possibly damaging Het
Ovch2 A G 7: 107,393,201 (GRCm39) L224P probably damaging Het
Patj A T 4: 98,409,047 (GRCm39) K34* probably null Het
Pcf11 T A 7: 92,308,016 (GRCm39) R717S possibly damaging Het
Plcb1 A T 2: 135,177,400 (GRCm39) E577D probably benign Het
Plxnb2 T C 15: 89,042,899 (GRCm39) K1497E probably damaging Het
Pyroxd1 C A 6: 142,299,266 (GRCm39) L141I probably damaging Het
Rhobtb3 G T 13: 76,020,537 (GRCm39) N588K probably benign Het
Rnasel G A 1: 153,629,452 (GRCm39) probably benign Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shank1 A T 7: 44,003,911 (GRCm39) I1868F possibly damaging Het
Slc28a3 A T 13: 58,706,463 (GRCm39) S593T probably damaging Het
Slc29a4 T C 5: 142,699,853 (GRCm39) I168T possibly damaging Het
Slc35f5 C T 1: 125,518,775 (GRCm39) P502L probably benign Het
Slco6d1 T C 1: 98,408,493 (GRCm39) I463T probably damaging Het
Slk A G 19: 47,608,451 (GRCm39) D468G probably benign Het
Spata31d1d G T 13: 59,874,322 (GRCm39) P1071Q probably damaging Het
Tert G A 13: 73,787,275 (GRCm39) V754I probably damaging Het
Thada T C 17: 84,759,155 (GRCm39) T235A probably benign Het
Ttn T C 2: 76,564,472 (GRCm39) D28555G probably damaging Het
Ttn T A 2: 76,710,328 (GRCm39) probably null Het
Ubqln4 T C 3: 88,472,575 (GRCm39) L464P probably damaging Het
Unc45b A T 11: 82,813,643 (GRCm39) N350I possibly damaging Het
Vmn2r65 T C 7: 84,589,900 (GRCm39) D672G probably benign Het
Zfp947 T A 17: 22,365,066 (GRCm39) I203L probably benign Het
Zfp964 T A 8: 70,116,766 (GRCm39) H454Q probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2083:Atp10b UTSW 11 43,103,250 (GRCm39) missense probably benign 0.24
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,063,572 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R3971:Atp10b UTSW 11 43,107,339 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9644:Atp10b UTSW 11 43,042,659 (GRCm39) missense probably damaging 1.00
R9747:Atp10b UTSW 11 43,088,339 (GRCm39) missense probably benign
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACAACACTGTGTCATGTGG -3'
(R):5'- TTCTCCAGCAGCTCTCTGAG -3'

Sequencing Primer
(F):5'- GTGAGATATGTACCTCCAGCTAGAC -3'
(R):5'- ACTTGATAGTCTATCAGAAAGCGG -3'
Posted On 2016-11-09