Incidental Mutation 'R5688:Unc45b'
ID443518
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Nameunc-45 myosin chaperone B
SynonymsCmya4, D230041A13Rik, UNC45
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5688 (G1)
Quality Score201
Status Not validated
Chromosome11
Chromosomal Location82910550-82943403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82922817 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 350 (N350I)
Ref Sequence ENSEMBL: ENSMUSP00000129405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018989
AA Change: N350I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: N350I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108160
AA Change: N350I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: N350I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156395
Predicted Effect possibly damaging
Transcript: ENSMUST00000164945
AA Change: N350I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: N350I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82912393 critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82936861 missense probably benign
IGL02083:Unc45b APN 11 82922919 missense probably damaging 0.96
IGL02159:Unc45b APN 11 82940181 splice site probably benign
IGL02160:Unc45b APN 11 82940181 splice site probably benign
IGL02165:Unc45b APN 11 82940181 splice site probably benign
IGL02166:Unc45b APN 11 82940181 splice site probably benign
IGL02986:Unc45b APN 11 82917179 missense probably damaging 0.98
fife UTSW 11 82936852 missense probably benign 0.00
mr_chicken UTSW 11 82913212 missense probably benign 0.00
R0195:Unc45b UTSW 11 82937828 missense probably damaging 1.00
R0197:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82911860 splice site probably benign
R0436:Unc45b UTSW 11 82929567 splice site probably benign
R0569:Unc45b UTSW 11 82936812 splice site probably benign
R0701:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1378:Unc45b UTSW 11 82936852 missense probably benign 0.00
R1446:Unc45b UTSW 11 82928670 missense probably damaging 1.00
R1532:Unc45b UTSW 11 82936874 missense probably benign 0.12
R1559:Unc45b UTSW 11 82917846 missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82925945 missense probably benign 0.30
R1628:Unc45b UTSW 11 82929380 intron probably null
R1666:Unc45b UTSW 11 82917739 missense probably benign 0.31
R1677:Unc45b UTSW 11 82911705 unclassified probably null
R1759:Unc45b UTSW 11 82929499 missense probably benign 0.33
R1909:Unc45b UTSW 11 82926087 missense probably damaging 1.00
R2067:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2111:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2145:Unc45b UTSW 11 82917754 missense probably benign 0.30
R2258:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2259:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2497:Unc45b UTSW 11 82936443 missense probably damaging 1.00
R2507:Unc45b UTSW 11 82940137 intron probably null
R4352:Unc45b UTSW 11 82913209 missense probably damaging 0.99
R4569:Unc45b UTSW 11 82936489 critical splice donor site probably null
R4624:Unc45b UTSW 11 82926009 missense probably benign 0.30
R5236:Unc45b UTSW 11 82915062 missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82915072 missense possibly damaging 0.47
R6029:Unc45b UTSW 11 82913327 missense probably damaging 1.00
R6616:Unc45b UTSW 11 82911819 missense probably damaging 1.00
R6857:Unc45b UTSW 11 82913212 missense probably benign 0.00
R6876:Unc45b UTSW 11 82922912 missense probably benign 0.00
R7197:Unc45b UTSW 11 82940187 critical splice acceptor site probably null
R7368:Unc45b UTSW 11 82942495 missense probably benign 0.01
R7531:Unc45b UTSW 11 82929012 missense probably damaging 1.00
R7743:Unc45b UTSW 11 82922900 missense probably damaging 1.00
T0970:Unc45b UTSW 11 82922888 missense probably benign 0.00
Z1176:Unc45b UTSW 11 82928654 critical splice acceptor site probably null
Z1176:Unc45b UTSW 11 82942715 missense probably damaging 1.00
Z1177:Unc45b UTSW 11 82942553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGGCCATGTACTGTCTGC -3'
(R):5'- GGAGAAAGACTCATCACAGCTG -3'

Sequencing Primer
(F):5'- TGTCTGCAGTCACAGCCG -3'
(R):5'- CAGCCTAGACCAGTGTGATTG -3'
Posted On2016-11-09