Incidental Mutation 'R5688:Gm7356'
ID 443534
Institutional Source Beutler Lab
Gene Symbol Gm7356
Ensembl Gene ENSMUSG00000101361
Gene Name predicted gene 7356
Synonyms
MMRRC Submission 043321-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R5688 (G1)
Quality Score 166
Status Not validated
Chromosome 17
Chromosomal Location 14220501-14223966 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14220869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 387 (I387F)
Ref Sequence ENSEMBL: ENSMUSP00000140965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186636]
AlphaFold A0A087WSA6
Predicted Effect possibly damaging
Transcript: ENSMUST00000186636
AA Change: I387F

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140965
Gene: ENSMUSG00000101361
AA Change: I387F

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
S_TKc 28 276 3.71e-91 SMART
UBA 296 333 1.35e-2 SMART
low complexity region 436 451 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,315,920 (GRCm39) A222V probably benign Het
Ahnak A G 19: 8,979,883 (GRCm39) D389G probably benign Het
Aldh1l2 A T 10: 83,337,789 (GRCm39) S559T possibly damaging Het
Alms1 T A 6: 85,576,877 (GRCm39) N144K possibly damaging Het
Anp32b T A 4: 46,469,868 (GRCm39) probably null Het
Atf7 C T 15: 102,459,944 (GRCm39) R57H probably damaging Het
Atp10b A T 11: 43,092,000 (GRCm39) H345L probably benign Het
Cacna2d1 A T 5: 16,563,950 (GRCm39) I859F probably damaging Het
Calcr T A 6: 3,714,730 (GRCm39) probably null Het
Cd248 A G 19: 5,119,963 (GRCm39) T604A probably benign Het
Cemip C T 7: 83,610,849 (GRCm39) V702M probably damaging Het
Cep295 G T 9: 15,243,282 (GRCm39) Q469K probably damaging Het
Cntn5 A G 9: 9,748,427 (GRCm39) W485R probably damaging Het
Cpe T C 8: 65,062,189 (GRCm39) N289S possibly damaging Het
Cyp2j11 G A 4: 96,233,358 (GRCm39) R113C probably damaging Het
Dcp1b T C 6: 119,194,872 (GRCm39) S531P probably benign Het
Defb7 T G 8: 19,545,167 (GRCm39) L15R probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Ednrb T C 14: 104,060,831 (GRCm39) D198G probably damaging Het
Engase A C 11: 118,378,146 (GRCm39) E312A possibly damaging Het
Evl G A 12: 108,639,612 (GRCm39) probably null Het
Faf1 C A 4: 109,652,010 (GRCm39) Q234K probably damaging Het
Garre1 T A 7: 33,953,416 (GRCm39) T449S possibly damaging Het
Garre1 T G 7: 33,984,134 (GRCm39) D163A probably damaging Het
Gm5460 C A 14: 33,767,752 (GRCm39) N453K possibly damaging Het
H1f2 A G 13: 23,923,148 (GRCm39) K106R probably damaging Het
Hagh T C 17: 25,069,568 (GRCm39) M1T probably null Het
Hars1 A T 18: 36,905,369 (GRCm39) V155E probably damaging Het
Lca5 C A 9: 83,280,619 (GRCm39) D394Y probably benign Het
Lmtk3 T C 7: 45,440,834 (GRCm39) L280P probably damaging Het
Lrit1 C T 14: 36,784,385 (GRCm39) A571V possibly damaging Het
Map4k2 C A 19: 6,396,836 (GRCm39) P584H probably damaging Het
Mgst1 T C 6: 138,118,798 (GRCm39) probably benign Het
Mtrex A T 13: 113,009,590 (GRCm39) C936* probably null Het
Neb C T 2: 52,086,339 (GRCm39) V5245I probably damaging Het
Oas3 T C 5: 120,896,867 (GRCm39) N918S probably benign Het
Or4c106 C T 2: 88,683,023 (GRCm39) T243I probably benign Het
Or5d16 T A 2: 87,773,552 (GRCm39) Q140L probably benign Het
Or8b8 A C 9: 37,809,359 (GRCm39) I220L possibly damaging Het
Ovch2 A G 7: 107,393,201 (GRCm39) L224P probably damaging Het
Patj A T 4: 98,409,047 (GRCm39) K34* probably null Het
Pcf11 T A 7: 92,308,016 (GRCm39) R717S possibly damaging Het
Plcb1 A T 2: 135,177,400 (GRCm39) E577D probably benign Het
Plxnb2 T C 15: 89,042,899 (GRCm39) K1497E probably damaging Het
Pyroxd1 C A 6: 142,299,266 (GRCm39) L141I probably damaging Het
Rhobtb3 G T 13: 76,020,537 (GRCm39) N588K probably benign Het
Rnasel G A 1: 153,629,452 (GRCm39) probably benign Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shank1 A T 7: 44,003,911 (GRCm39) I1868F possibly damaging Het
Slc28a3 A T 13: 58,706,463 (GRCm39) S593T probably damaging Het
Slc29a4 T C 5: 142,699,853 (GRCm39) I168T possibly damaging Het
Slc35f5 C T 1: 125,518,775 (GRCm39) P502L probably benign Het
Slco6d1 T C 1: 98,408,493 (GRCm39) I463T probably damaging Het
Slk A G 19: 47,608,451 (GRCm39) D468G probably benign Het
Spata31d1d G T 13: 59,874,322 (GRCm39) P1071Q probably damaging Het
Tert G A 13: 73,787,275 (GRCm39) V754I probably damaging Het
Thada T C 17: 84,759,155 (GRCm39) T235A probably benign Het
Ttn T C 2: 76,564,472 (GRCm39) D28555G probably damaging Het
Ttn T A 2: 76,710,328 (GRCm39) probably null Het
Ubqln4 T C 3: 88,472,575 (GRCm39) L464P probably damaging Het
Unc45b A T 11: 82,813,643 (GRCm39) N350I possibly damaging Het
Vmn2r65 T C 7: 84,589,900 (GRCm39) D672G probably benign Het
Zfp947 T A 17: 22,365,066 (GRCm39) I203L probably benign Het
Zfp964 T A 8: 70,116,766 (GRCm39) H454Q probably benign Het
Other mutations in Gm7356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Gm7356 APN 17 14,221,537 (GRCm39) missense probably damaging 1.00
PIT4504001:Gm7356 UTSW 17 14,221,720 (GRCm39) missense probably damaging 1.00
R4533:Gm7356 UTSW 17 14,221,672 (GRCm39) missense probably damaging 1.00
R4912:Gm7356 UTSW 17 14,221,498 (GRCm39) missense possibly damaging 0.82
R5125:Gm7356 UTSW 17 14,221,576 (GRCm39) missense probably damaging 1.00
R5208:Gm7356 UTSW 17 14,221,456 (GRCm39) missense probably damaging 1.00
R5342:Gm7356 UTSW 17 14,221,360 (GRCm39) missense possibly damaging 0.55
R6002:Gm7356 UTSW 17 14,221,001 (GRCm39) missense probably benign 0.00
R6478:Gm7356 UTSW 17 14,221,726 (GRCm39) missense probably damaging 0.98
R6932:Gm7356 UTSW 17 14,221,925 (GRCm39) missense probably damaging 1.00
R6939:Gm7356 UTSW 17 14,221,387 (GRCm39) missense probably benign 0.01
R7291:Gm7356 UTSW 17 14,221,843 (GRCm39) missense probably benign 0.06
R7480:Gm7356 UTSW 17 14,221,327 (GRCm39) missense possibly damaging 0.74
R8157:Gm7356 UTSW 17 14,221,583 (GRCm39) missense probably damaging 1.00
R8305:Gm7356 UTSW 17 14,221,699 (GRCm39) missense probably benign 0.15
R8936:Gm7356 UTSW 17 14,221,937 (GRCm39) missense probably benign 0.00
R9068:Gm7356 UTSW 17 14,221,687 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGCACTGTTGGAGAGATTCTC -3'
(R):5'- CCTGACATTGTAGATGCGATGC -3'

Sequencing Primer
(F):5'- GCACTGTTGGAGAGATTCTCTTCTC -3'
(R):5'- CATTGTAGATGCGATGCAGTATATTG -3'
Posted On 2016-11-09