Incidental Mutation 'R5688:Hagh'
ID443536
Institutional Source Beutler Lab
Gene Symbol Hagh
Ensembl Gene ENSMUSG00000024158
Gene Namehydroxyacyl glutathione hydrolase
SynonymsRsp29, Glo-2, Glo2
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5688 (G1)
Quality Score110
Status Not validated
Chromosome17
Chromosomal Location24840143-24864450 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 24850594 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000126514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024974] [ENSMUST00000049642] [ENSMUST00000118788] [ENSMUST00000130989] [ENSMUST00000149716] [ENSMUST00000154363] [ENSMUST00000164251] [ENSMUST00000169200]
Predicted Effect probably benign
Transcript: ENSMUST00000024974
SMART Domains Protein: ENSMUSP00000024974
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 173 2.61e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049642
SMART Domains Protein: ENSMUSP00000055827
Gene: ENSMUSG00000045316

DomainStartEndE-ValueType
Pfam:FAA_hydrolase 22 223 4e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118788
AA Change: M1T
SMART Domains Protein: ENSMUSP00000113051
Gene: ENSMUSG00000024158
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
Lactamase_B 60 222 2.61e-32 SMART
Pfam:HAGH_C 223 304 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130989
SMART Domains Protein: ENSMUSP00000120734
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 166 1.53e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149716
SMART Domains Protein: ENSMUSP00000114838
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 132 1.22e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154363
AA Change: M1T
SMART Domains Protein: ENSMUSP00000114672
Gene: ENSMUSG00000024158
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
Pfam:Lactamase_B 56 106 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164251
SMART Domains Protein: ENSMUSP00000129904
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 173 2.61e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169200
AA Change: M1T
SMART Domains Protein: ENSMUSP00000126514
Gene: ENSMUSG00000024158
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Lactamase_B 23 150 2.66e-1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T A 2: 76,879,984 probably null Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Hagh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02224:Hagh APN 17 24852887 missense probably damaging 1.00
IGL03410:Hagh APN 17 24860942 splice site probably benign
R0616:Hagh UTSW 17 24857577 missense probably damaging 1.00
R6127:Hagh UTSW 17 24861004 missense probably damaging 1.00
R7381:Hagh UTSW 17 24856712 missense probably damaging 1.00
R7524:Hagh UTSW 17 24861340 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTGTGAACTCTATGGGC -3'
(R):5'- GCCAGATGCCTATTCCAAGG -3'

Sequencing Primer
(F):5'- TGAACTCTATGGGCGGTCAC -3'
(R):5'- TATTCCAAGGCCCTCAACACG -3'
Posted On2016-11-09