Mutagenetix > Incidental Mutation

Incidental Mutation 'R5689:Ptprc'

443546

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

043322-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138117777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 164 (V164A)

Ref Sequence

ENSEMBL: ENSMUSP00000138350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]

AlphaFold

P06800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182283

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182755

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183262

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: V164A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V164A

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188596

Predicted Effect

probably benign
Transcript: ENSMUST00000193650

SMART Domains

Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	8.4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195533

SMART Domains

Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	7.4e-11	PFAM
low complexity region	68	115	N/A	INTRINSIC
Pfam:CD45	121	180	2.1e-22	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lnx2	A	T	5: 147,029,151	V386E	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Pde4dip	A	T	3: 97,692,367	L2384*	probably null	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Rapsn	T	C	2: 91,035,924	F43S	probably damaging	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Slitrk6	C	T	14: 110,752,126	E50K	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Vps16	C	T	2: 130,439,091	Q226*	probably null	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8824:Ptprc	UTSW	1	138113708	nonsense	probably null
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTCTAGAAAAGTTCAAGCAGTTGG -3'
(R):5'- TACTCACATCCATGGCAGCATG -3'

Sequencing Primer
(F):5'- GAAAAGTTCAAGCAGTTGGATTAATC -3'
(R):5'- CATGTGGCATGATGGAGTGATAG -3'

Posted On

2016-11-09