Incidental Mutation 'R5689:Ptprc'
ID 443546
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Name protein tyrosine phosphatase receptor type C
Synonyms Ly-5, T200, CD45, B220, Lyt-4
MMRRC Submission 043322-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5689 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 137990599-138103446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138045515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000138350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]
AlphaFold P06800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182283
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182755
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183262
Predicted Effect probably benign
Transcript: ENSMUST00000183301
AA Change: V164A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V164A

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188596
Predicted Effect probably benign
Transcript: ENSMUST00000193650
SMART Domains Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195533
SMART Domains Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 7.4e-11 PFAM
low complexity region 68 115 N/A INTRINSIC
Pfam:CD45 121 180 2.1e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 89,051,412 (GRCm39) C844F probably benign Het
Afdn T C 17: 14,075,621 (GRCm39) V945A probably damaging Het
Aimp2 T C 5: 143,843,389 (GRCm39) D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Atp11b G T 3: 35,888,501 (GRCm39) V924F possibly damaging Het
Atp8b1 C T 18: 64,697,608 (GRCm39) R412H probably damaging Het
Cfb T A 17: 35,080,770 (GRCm39) T76S probably benign Het
Cmpk2 A T 12: 26,519,766 (GRCm39) H139L probably benign Het
Cypt4 T C 9: 24,536,542 (GRCm39) S11P possibly damaging Het
Dbx1 A G 7: 49,282,519 (GRCm39) F229L probably damaging Het
Dnah6 T A 6: 72,998,210 (GRCm39) M4071L probably benign Het
Dnah7a A G 1: 53,444,857 (GRCm39) V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 (GRCm39) E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 (GRCm39) V263F probably damaging Het
Eno4 T A 19: 58,959,088 (GRCm39) D403E probably benign Het
Evi5l C T 8: 4,255,460 (GRCm39) Q542* probably null Het
Fam135a A G 1: 24,068,134 (GRCm39) S12P probably benign Het
Flnc G A 6: 29,441,591 (GRCm39) A458T probably benign Het
Fnip1 T C 11: 54,393,115 (GRCm39) V517A probably damaging Het
Galc G T 12: 98,179,245 (GRCm39) H361N possibly damaging Het
Gask1a T C 9: 121,794,754 (GRCm39) F303L probably damaging Het
Gcnt1 T A 19: 17,306,768 (GRCm39) D319V probably damaging Het
Gm26996 T C 6: 130,555,258 (GRCm39) noncoding transcript Het
Gm5321 A T 7: 6,022,268 (GRCm39) noncoding transcript Het
Grin3b T C 10: 79,810,465 (GRCm39) L657P probably damaging Het
Gstm5 T C 3: 107,803,981 (GRCm39) F54S probably damaging Het
Ilk C A 7: 105,390,857 (GRCm39) L267I probably benign Het
Lifr A G 15: 7,214,285 (GRCm39) Y713C probably damaging Het
Lnx2 A T 5: 146,965,961 (GRCm39) V386E probably damaging Het
Lrch1 T C 14: 75,023,764 (GRCm39) E587G probably damaging Het
Or10g3 C T 14: 52,610,214 (GRCm39) V99M possibly damaging Het
Osgin1 A G 8: 120,171,728 (GRCm39) *173W probably null Het
Pcdhga7 C A 18: 37,849,736 (GRCm39) P581H probably damaging Het
Pde4dip A T 3: 97,599,683 (GRCm39) L2384* probably null Het
Phf12 T A 11: 77,914,551 (GRCm39) N115K probably damaging Het
Pmel A G 10: 128,552,170 (GRCm39) T335A probably damaging Het
Polr3e C A 7: 120,539,912 (GRCm39) T579K possibly damaging Het
Rapsn T C 2: 90,866,269 (GRCm39) F43S probably damaging Het
Rarb T A 14: 16,434,177 (GRCm38) I334F probably damaging Het
Rev3l T C 10: 39,670,954 (GRCm39) Y167H probably damaging Het
Rnf146 T C 10: 29,223,800 (GRCm39) T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,229,141 (GRCm39) probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc5a10 C T 11: 61,598,710 (GRCm39) M223I probably benign Het
Slc7a11 C G 3: 50,326,780 (GRCm39) V494L probably benign Het
Slitrk6 C T 14: 110,989,558 (GRCm39) E50K probably benign Het
Smg8 A G 11: 86,975,949 (GRCm39) F544S probably damaging Het
Tnpo3 T C 6: 29,571,063 (GRCm39) M444V possibly damaging Het
Trav7d-4 G A 14: 53,007,651 (GRCm39) R48H probably damaging Het
Trim50 A T 5: 135,382,516 (GRCm39) T123S probably damaging Het
Trpc4ap C G 2: 155,512,955 (GRCm39) probably null Het
Ttn T A 2: 76,618,620 (GRCm39) R14475S probably damaging Het
Uts2 A T 4: 151,083,565 (GRCm39) T59S possibly damaging Het
Vmn1r52 T C 6: 90,156,232 (GRCm39) S179P possibly damaging Het
Vmn2r116 A G 17: 23,616,693 (GRCm39) H537R probably benign Het
Vps16 C T 2: 130,281,011 (GRCm39) Q226* probably null Het
Zfhx2 T C 14: 55,311,360 (GRCm39) T445A possibly damaging Het
Zfp638 T C 6: 83,906,054 (GRCm39) V73A probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138,011,528 (GRCm39) splice site probably benign
IGL00486:Ptprc APN 1 138,043,359 (GRCm39) missense probably damaging 0.97
IGL00771:Ptprc APN 1 138,041,415 (GRCm39) missense probably benign 0.00
IGL00833:Ptprc APN 1 138,006,230 (GRCm39) missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138,041,380 (GRCm39) missense probably damaging 1.00
IGL01020:Ptprc APN 1 138,047,911 (GRCm39) critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138,008,650 (GRCm39) missense probably damaging 1.00
IGL01302:Ptprc APN 1 138,027,369 (GRCm39) missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138,027,219 (GRCm39) critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 137,996,148 (GRCm39) missense possibly damaging 0.88
IGL01775:Ptprc APN 1 137,992,497 (GRCm39) missense probably damaging 1.00
IGL01820:Ptprc APN 1 137,993,936 (GRCm39) missense probably damaging 1.00
IGL02340:Ptprc APN 1 137,998,957 (GRCm39) missense probably damaging 1.00
IGL02943:Ptprc APN 1 138,027,251 (GRCm39) missense probably damaging 0.99
IGL03169:Ptprc APN 1 138,041,357 (GRCm39) missense probably benign 0.15
IGL03308:Ptprc APN 1 138,054,058 (GRCm39) missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138,020,739 (GRCm39) missense probably damaging 1.00
belittle UTSW 1 138,137,493 (GRCm38) intron probably benign
Benighted UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
bletchley UTSW 1 138,045,600 (GRCm39) missense probably benign
Blush UTSW 1 138,045,458 (GRCm39) intron probably benign
bruise UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
chor_muang UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
crystal UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
Dumpling UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
fluorescent UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
fuchsia UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
Gentian UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
guotie UTSW 1 137,996,139 (GRCm39) nonsense probably null
guotie2 UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
Guotie3 UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
Gyoza UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
Half_measure UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
jirisan UTSW 1 138,041,416 (GRCm39) nonsense probably null
mauve UTSW 1 138,027,423 (GRCm39) missense probably benign
Perverse UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
petechiae UTSW 1 138,041,446 (GRCm39) nonsense probably null
ultra UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
violaceous UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138,041,297 (GRCm39) splice site probably null
R0189:Ptprc UTSW 1 138,010,453 (GRCm39) missense probably benign 0.10
R0390:Ptprc UTSW 1 138,050,313 (GRCm39) missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138,016,435 (GRCm39) missense probably damaging 1.00
R0602:Ptprc UTSW 1 138,017,223 (GRCm39) splice site probably benign
R0627:Ptprc UTSW 1 137,996,058 (GRCm39) missense probably damaging 0.99
R0632:Ptprc UTSW 1 138,001,348 (GRCm39) missense probably benign 0.01
R0751:Ptprc UTSW 1 138,020,668 (GRCm39) missense probably damaging 1.00
R0839:Ptprc UTSW 1 138,028,870 (GRCm39) missense possibly damaging 0.47
R0942:Ptprc UTSW 1 137,996,139 (GRCm39) nonsense probably null
R0943:Ptprc UTSW 1 138,038,902 (GRCm39) missense probably damaging 0.96
R1159:Ptprc UTSW 1 138,000,057 (GRCm39) missense probably damaging 1.00
R1442:Ptprc UTSW 1 138,000,050 (GRCm39) missense probably damaging 1.00
R1489:Ptprc UTSW 1 138,047,824 (GRCm39) missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1728:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1728:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1728:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1728:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1729:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1729:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1730:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1730:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1730:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1730:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1739:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1739:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1739:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1739:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1762:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1762:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1762:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1762:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1783:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1783:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1783:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1784:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1784:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1784:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1785:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1785:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1785:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1785:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1862:Ptprc UTSW 1 138,039,965 (GRCm39) missense probably benign 0.13
R2145:Ptprc UTSW 1 138,001,419 (GRCm39) missense probably damaging 1.00
R2290:Ptprc UTSW 1 138,038,926 (GRCm39) missense probably benign 0.00
R2403:Ptprc UTSW 1 138,016,270 (GRCm39) missense probably damaging 1.00
R2439:Ptprc UTSW 1 137,993,890 (GRCm39) missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138,007,916 (GRCm39) missense probably damaging 1.00
R2906:Ptprc UTSW 1 137,992,272 (GRCm39) missense possibly damaging 0.93
R3774:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3775:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3776:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3834:Ptprc UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
R4019:Ptprc UTSW 1 138,006,254 (GRCm39) missense probably damaging 1.00
R4377:Ptprc UTSW 1 137,995,663 (GRCm39) missense probably benign 0.04
R4580:Ptprc UTSW 1 137,998,989 (GRCm39) missense probably benign 0.09
R4923:Ptprc UTSW 1 138,006,236 (GRCm39) missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138,027,235 (GRCm39) missense probably benign 0.04
R4937:Ptprc UTSW 1 138,017,238 (GRCm39) missense probably damaging 1.00
R4970:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5112:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5145:Ptprc UTSW 1 138,017,304 (GRCm39) missense probably benign 0.07
R5158:Ptprc UTSW 1 138,102,822 (GRCm39) missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R5593:Ptprc UTSW 1 138,045,458 (GRCm39) intron probably benign
R5885:Ptprc UTSW 1 138,016,246 (GRCm39) missense probably damaging 1.00
R6010:Ptprc UTSW 1 138,028,794 (GRCm39) missense probably benign 0.09
R6026:Ptprc UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
R6047:Ptprc UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
R6173:Ptprc UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
R6328:Ptprc UTSW 1 138,041,416 (GRCm39) nonsense probably null
R6383:Ptprc UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
R6520:Ptprc UTSW 1 138,007,881 (GRCm39) nonsense probably null
R6805:Ptprc UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
R6830:Ptprc UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
R6847:Ptprc UTSW 1 138,016,283 (GRCm39) missense probably damaging 0.99
R6960:Ptprc UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
R6995:Ptprc UTSW 1 138,016,482 (GRCm39) missense probably damaging 1.00
R7009:Ptprc UTSW 1 137,992,291 (GRCm39) missense probably damaging 0.97
R7041:Ptprc UTSW 1 138,054,047 (GRCm39) missense probably benign 0.04
R7055:Ptprc UTSW 1 138,017,309 (GRCm39) missense probably damaging 1.00
R7098:Ptprc UTSW 1 138,027,423 (GRCm39) missense probably benign
R7164:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7188:Ptprc UTSW 1 137,998,918 (GRCm39) missense probably damaging 1.00
R7191:Ptprc UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
R7204:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7316:Ptprc UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
R7644:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
R7948:Ptprc UTSW 1 137,992,314 (GRCm39) missense probably benign 0.45
R8029:Ptprc UTSW 1 138,006,197 (GRCm39) missense probably damaging 1.00
R8677:Ptprc UTSW 1 138,011,335 (GRCm39) missense probably damaging 1.00
R8704:Ptprc UTSW 1 138,043,362 (GRCm39) missense probably benign 0.34
R8824:Ptprc UTSW 1 138,041,446 (GRCm39) nonsense probably null
R8921:Ptprc UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
R8998:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R8999:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R9154:Ptprc UTSW 1 138,016,302 (GRCm39) missense probably damaging 1.00
R9388:Ptprc UTSW 1 138,011,380 (GRCm39) missense possibly damaging 0.87
R9428:Ptprc UTSW 1 138,041,485 (GRCm39) missense probably benign 0.01
R9467:Ptprc UTSW 1 137,993,960 (GRCm39) missense probably damaging 1.00
R9468:Ptprc UTSW 1 138,044,754 (GRCm39) missense probably benign 0.01
R9479:Ptprc UTSW 1 138,001,388 (GRCm39) missense probably benign 0.38
R9526:Ptprc UTSW 1 137,996,111 (GRCm39) missense probably benign 0.02
R9632:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9710:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9714:Ptprc UTSW 1 138,008,687 (GRCm39) missense probably damaging 1.00
R9777:Ptprc UTSW 1 138,047,901 (GRCm39) missense
Z1177:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTAGAAAAGTTCAAGCAGTTGG -3'
(R):5'- TACTCACATCCATGGCAGCATG -3'

Sequencing Primer
(F):5'- GAAAAGTTCAAGCAGTTGGATTAATC -3'
(R):5'- CATGTGGCATGATGGAGTGATAG -3'
Posted On 2016-11-09