Incidental Mutation 'R5689:Ptprc'
ID443546
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138117777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000138350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182283
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182755
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183262
Predicted Effect probably benign
Transcript: ENSMUST00000183301
AA Change: V164A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V164A

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188596
Predicted Effect probably benign
Transcript: ENSMUST00000193650
SMART Domains Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195533
SMART Domains Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 7.4e-11 PFAM
low complexity region 68 115 N/A INTRINSIC
Pfam:CD45 121 180 2.1e-22 PFAM
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTAGAAAAGTTCAAGCAGTTGG -3'
(R):5'- TACTCACATCCATGGCAGCATG -3'

Sequencing Primer
(F):5'- GAAAAGTTCAAGCAGTTGGATTAATC -3'
(R):5'- CATGTGGCATGATGGAGTGATAG -3'
Posted On2016-11-09