Mutagenetix > Incidental Mutation

Incidental Mutation 'R5689:Rapsn'

443548

Institutional Source

Beutler Lab

Gene Symbol

Rapsn

Ensembl Gene

ENSMUSG00000002104

Gene Name

receptor-associated protein of the synapse

Synonyms

Nraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps

MMRRC Submission

043322-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91035620-91045729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91035924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 43 (F43S)

Ref Sequence

ENSEMBL: ENSMUSP00000107073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]

AlphaFold

P12672

Predicted Effect

probably damaging
Transcript: ENSMUST00000050323
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: F43S

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	2e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
TPR	163	196	8.29e0	SMART
TPR	206	239	1.24e0	SMART
Blast:TPR	246	279	1e-14	BLAST
TPR	286	319	2.07e1	SMART
RING	363	402	2.67e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111445
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: F43S

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	1e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
TPR	163	196	8.29e0	SMART
TPR	206	239	1.24e0	SMART
RING	304	343	2.67e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111446
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: F43S

Domain	Start	End	E-Value	Type
TPR	6	39	5.62e1	SMART
Blast:TPR	43	74	1e-10	BLAST
TPR	83	116	2.56e1	SMART
TPR	123	156	1.11e-2	SMART
Blast:TPR	193	226	9e-15	BLAST
TPR	233	266	2.07e1	SMART
RING	310	349	2.67e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118208

Meta Mutation Damage Score

0.7129

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lnx2	A	T	5: 147,029,151	V386E	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Pde4dip	A	T	3: 97,692,367	L2384*	probably null	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Ptprc	A	G	1: 138,117,777	V164A	probably benign	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Slitrk6	C	T	14: 110,752,126	E50K	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Vps16	C	T	2: 130,439,091	Q226*	probably null	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Rapsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rapsn	APN	2	91035860	missense	probably damaging	1.00
IGL01386:Rapsn	APN	2	91036799	missense	probably damaging	1.00
IGL01517:Rapsn	APN	2	91036618	missense	probably damaging	1.00
IGL01707:Rapsn	APN	2	91043240	missense	probably benign	0.03
IGL02322:Rapsn	APN	2	91041906	missense	possibly damaging	0.80
IGL02800:Rapsn	APN	2	91043239	missense	probably benign
hermitage	UTSW	2	91036827	missense	probably damaging	1.00
rasputin	UTSW	2	91035924	missense	probably damaging	1.00
tsarina	UTSW	2	91045514	missense	probably damaging	1.00
R0744:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R0833:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R0836:Rapsn	UTSW	2	91036808	missense	probably damaging	0.99
R1224:Rapsn	UTSW	2	91043198	missense	probably damaging	1.00
R1294:Rapsn	UTSW	2	91036775	nonsense	probably null
R1619:Rapsn	UTSW	2	91043159	missense	possibly damaging	0.84
R2891:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R2892:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R2893:Rapsn	UTSW	2	91036824	missense	probably damaging	0.98
R4135:Rapsn	UTSW	2	91036817	missense	probably damaging	0.99
R4515:Rapsn	UTSW	2	91043212	missense	possibly damaging	0.91
R5860:Rapsn	UTSW	2	91045514	missense	probably damaging	1.00
R5953:Rapsn	UTSW	2	91041963	missense	probably benign	0.04
R6495:Rapsn	UTSW	2	91036628	missense	probably damaging	1.00
R7644:Rapsn	UTSW	2	91041954	missense	possibly damaging	0.80
R7775:Rapsn	UTSW	2	91044948	missense	probably benign	0.02
R7778:Rapsn	UTSW	2	91044948	missense	probably benign	0.02
R7896:Rapsn	UTSW	2	91044955	missense	probably benign	0.06
R9016:Rapsn	UTSW	2	91036827	missense	probably damaging	1.00
R9118:Rapsn	UTSW	2	91045033	missense	probably damaging	1.00
R9643:Rapsn	UTSW	2	91041923	missense	probably damaging	1.00
R9746:Rapsn	UTSW	2	91045478	missense	probably damaging	1.00
R9748:Rapsn	UTSW	2	91045478	missense	probably damaging	1.00
X0064:Rapsn	UTSW	2	91043003	missense	probably benign	0.14
Z1176:Rapsn	UTSW	2	91036598	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGGTCTAAAGACACCTAGCCAG -3'
(R):5'- AGACTCAGGATCTCCCATGC -3'

Sequencing Primer
(F):5'- AGCCAGCCACGGTCTTTC -3'
(R):5'- CCAGAGGTTCTCACTCAGGAAG -3'

Posted On

2016-11-09