Mutagenetix > Incidental Mutations

Incidental Mutation 'R5689:Vps16'

443549

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

043322-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 130439091 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 226 (Q226*)

Ref Sequence

ENSEMBL: ENSMUSP00000115899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

Predicted Effect

probably null
Transcript: ENSMUST00000028900
AA Change: Q267*

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: Q267*

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

probably null
Transcript: ENSMUST00000128994
AA Change: Q226*

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: Q226*

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lnx2	A	T	5: 147,029,151	V386E	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Pde4dip	A	T	3: 97,692,367	L2384*	probably null	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Ptprc	A	G	1: 138,117,777	V164A	probably benign	Het
Rapsn	T	C	2: 91,035,924	F43S	probably damaging	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Slitrk6	C	T	14: 110,752,126	E50K	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTGGTTCTAGGACAGCAAG -3'
(R):5'- GCCACATGCTGACCTATCTG -3'

Sequencing Primer
(F):5'- CAAGGGATACTGTGCTTTGTCCAAG -3'
(R):5'- GCTCTTACACTACCAGTCAAGTGG -3'

Posted On

2016-11-09