Incidental Mutation 'R5689:Trpc4ap'
ID443551
Institutional Source Beutler Lab
Gene Symbol Trpc4ap
Ensembl Gene ENSMUSG00000038324
Gene Nametransient receptor potential cation channel, subfamily C, member 4 associated protein
SynonymsD2Ertd113e, Trrp4ap, 4833429F06Rik, Trp4-associated protein TAP1
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155634271-155692384 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to G at 155671035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000103140]
Predicted Effect probably null
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152548
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Trpc4ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Trpc4ap APN 2 155639535 missense possibly damaging 0.90
IGL02149:Trpc4ap APN 2 155639547 missense probably damaging 0.97
IGL02313:Trpc4ap APN 2 155650468 missense probably damaging 1.00
IGL02408:Trpc4ap APN 2 155671069 missense possibly damaging 0.71
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0255:Trpc4ap UTSW 2 155657946 splice site probably benign
R0306:Trpc4ap UTSW 2 155636260 missense probably benign 0.37
R0382:Trpc4ap UTSW 2 155636230 missense probably damaging 1.00
R0525:Trpc4ap UTSW 2 155640478 missense possibly damaging 0.85
R1184:Trpc4ap UTSW 2 155645070 splice site probably benign
R1711:Trpc4ap UTSW 2 155657744 missense probably benign 0.01
R2113:Trpc4ap UTSW 2 155657936 missense probably damaging 0.99
R3810:Trpc4ap UTSW 2 155643435 missense probably damaging 1.00
R4384:Trpc4ap UTSW 2 155640507 missense possibly damaging 0.85
R4664:Trpc4ap UTSW 2 155672997 missense probably benign 0.04
R4690:Trpc4ap UTSW 2 155635133 missense probably damaging 0.97
R5347:Trpc4ap UTSW 2 155672988 critical splice donor site probably null
R5655:Trpc4ap UTSW 2 155653627 missense possibly damaging 0.95
R5828:Trpc4ap UTSW 2 155635210 intron probably benign
R5894:Trpc4ap UTSW 2 155666213 missense probably benign 0.11
R6056:Trpc4ap UTSW 2 155671074 missense probably damaging 1.00
R6289:Trpc4ap UTSW 2 155663707 missense possibly damaging 0.90
R6539:Trpc4ap UTSW 2 155636258 missense probably benign 0.00
R6682:Trpc4ap UTSW 2 155637767 critical splice acceptor site probably null
R7022:Trpc4ap UTSW 2 155657822 missense probably benign 0.01
R7031:Trpc4ap UTSW 2 155692215 missense unknown
X0018:Trpc4ap UTSW 2 155653564 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGTAAGAACCAGCCTCAAG -3'
(R):5'- ACTTCATTGAGGGCTAGCTTTG -3'

Sequencing Primer
(F):5'- GGTGACACACAGCTTTGATC -3'
(R):5'- CATTGAGGGCTAGCTTTGTTCAG -3'
Posted On2016-11-09