Incidental Mutation 'R5689:Aqp7'
ID443555
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Nameaquaporin 7
SynonymsAQPap, AQP7L
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41033074-41048139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41035510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 115 (T115I)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149517
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41045321 nonsense probably null
IGL01871:Aqp7 APN 4 41045321 nonsense probably null
IGL02173:Aqp7 APN 4 41034379 nonsense probably null
IGL03139:Aqp7 APN 4 41045326 missense probably benign 0.00
IGL03237:Aqp7 APN 4 41034884 missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41045270 splice site probably benign
acadia UTSW 4 41035510 missense probably benign 0.00
IGL03055:Aqp7 UTSW 4 41045326 missense probably benign 0.00
R0884:Aqp7 UTSW 4 41034929 missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41036109 missense probably null 0.74
R3551:Aqp7 UTSW 4 41045329 missense probably benign 0.04
R5340:Aqp7 UTSW 4 41034347 missense probably benign
R5690:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5691:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5692:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5710:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5711:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5713:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5751:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5817:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5820:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5921:Aqp7 UTSW 4 41036093 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGGGCTTTACTCTACTAGGG -3'
(R):5'- TGCGGTCTTTTCACAGAGAAC -3'

Sequencing Primer
(F):5'- GCTTTACTCTACTAGGGTTGGG -3'
(R):5'- GGTCTTTTCACAGAGAACATCCC -3'
Posted On2016-11-09